ID: 998663097

View in Genome Browser
Species Human (GRCh38)
Location 5:144262858-144262880
Sequence ATCTGTTCATGAGCTCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998663093_998663097 -9 Left 998663093 5:144262844-144262866 CCCTTGCCCTGTCTATCTGTTCA 0: 1
1: 0
2: 0
3: 26
4: 358
Right 998663097 5:144262858-144262880 ATCTGTTCATGAGCTCTCTGAGG 0: 1
1: 0
2: 1
3: 14
4: 195
998663094_998663097 -10 Left 998663094 5:144262845-144262867 CCTTGCCCTGTCTATCTGTTCAT 0: 1
1: 0
2: 11
3: 96
4: 576
Right 998663097 5:144262858-144262880 ATCTGTTCATGAGCTCTCTGAGG 0: 1
1: 0
2: 1
3: 14
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998663097 Original CRISPR ATCTGTTCATGAGCTCTCTG AGG Intronic
901711743 1:11121156-11121178 ATCTGTTCATGTGCACACAGCGG - Intronic
904471866 1:30741135-30741157 ATCAGATCATGAGCTCTCTGGGG + Intronic
906489885 1:46260065-46260087 AGCTGGTCATGAGCGCTCAGCGG - Exonic
906759840 1:48366418-48366440 ATCTGGTCATGGACTCTCTTTGG + Intronic
907970762 1:59378612-59378634 ATCTGTTCAGGAGCTTGGTGGGG - Intronic
909533217 1:76704193-76704215 ATTTATTTATGAGGTCTCTGTGG + Intergenic
910753134 1:90655932-90655954 AACTGTTCATGTATTCTCTGTGG + Intergenic
911941076 1:104048371-104048393 ATCTCTTCATGAGATCGGTGGGG + Intergenic
912625154 1:111200211-111200233 AGCTGGTCATGCCCTCTCTGGGG - Intronic
913338433 1:117732931-117732953 ATCTGCACATCAGCTCTGTGAGG - Intergenic
915996101 1:160565492-160565514 ATCTGGTCATTAGCGATCTGAGG - Exonic
916874665 1:168956311-168956333 ATCTGTTCCTGGGCTTTCTTTGG + Intergenic
920064273 1:203255735-203255757 ATGTGTACATGAGCCCCCTGAGG + Intronic
920649008 1:207823078-207823100 ATCTGGTTAGGAGCTCTATGGGG - Intergenic
1063022743 10:2146136-2146158 CTCCGTTCCTGAGCTCTGTGAGG + Intergenic
1063398517 10:5717305-5717327 ATATCTTCATGAGCACCCTGTGG + Intronic
1063880239 10:10523747-10523769 ACTTGATCATGAGCTCTGTGAGG - Intergenic
1064260224 10:13779596-13779618 ATCTGTTAATTTGCTTTCTGTGG + Intronic
1066791745 10:39072660-39072682 ATCTGTGAAAGTGCTCTCTGAGG + Intergenic
1068312659 10:55298067-55298089 ATCTGTCCGGGAGCTCTGTGTGG - Intronic
1071469609 10:85974164-85974186 ATCTGGTCATGAGCTTGCTTTGG - Intronic
1075513358 10:123089897-123089919 ATCAGGGGATGAGCTCTCTGAGG + Intergenic
1076127834 10:127989916-127989938 ATTTGTTCATTCGCTCACTGAGG + Intronic
1079839496 11:25378154-25378176 AGCTGTTCATTATCTTTCTGTGG + Intergenic
1080984512 11:37445352-37445374 ATCTTTACATGAGCACTATGTGG + Intergenic
1081952042 11:47052807-47052829 ATCTTTACAAGGGCTCTCTGTGG + Intronic
1085874364 11:80388168-80388190 ATCTGTCCTTGAGCTCACGGTGG - Intergenic
1086527250 11:87742052-87742074 ATTTGTTACTGAGCTCTCTAAGG + Intergenic
1087106225 11:94410201-94410223 ATTTCTTCATTAGCTCTCAGAGG + Intergenic
1087651764 11:100875910-100875932 ACCTGTTTATGTGTTCTCTGTGG + Intronic
1088440895 11:109868774-109868796 CTTTGCTCTTGAGCTCTCTGGGG + Intergenic
1089024494 11:115255008-115255030 ATCAGCTCCTGAGCACTCTGTGG - Intronic
1089293637 11:117454774-117454796 ATCTGGGCATGAGCAATCTGGGG + Intronic
1094360124 12:29621706-29621728 CTCTGTTTATCAGCTCTGTGTGG + Intronic
1094861045 12:34466671-34466693 ATCTGGTCCTGAGCTTTTTGTGG + Intergenic
1095415311 12:41970224-41970246 ATCATATCATGAGCTTTCTGAGG - Intergenic
1095939409 12:47716339-47716361 CTGTCTTCATGATCTCTCTGAGG + Exonic
1096402751 12:51320865-51320887 ATCTGTTTGTGATTTCTCTGTGG - Intronic
1098059342 12:66543559-66543581 ATGTTTTCATGAGATTTCTGGGG - Intronic
1098092273 12:66916267-66916289 ATCTGTACATCAACTCCCTGAGG + Intergenic
1098848593 12:75567804-75567826 ACCTGCTCAAGAGGTCTCTGGGG - Intergenic
1098937901 12:76501609-76501631 CTTTGTTCATGAGCCCACTGTGG - Intronic
1102402519 12:112642246-112642268 ATTTTTTCAAGAACTCTCTGAGG + Intronic
1102683963 12:114709912-114709934 GTCTATTCATGAGCAATCTGGGG + Intergenic
1102710144 12:114918755-114918777 ATCTTTACAGCAGCTCTCTGAGG - Intergenic
1104023590 12:125010261-125010283 ATATATTCATAAGCTCTCTGGGG - Intronic
1104295497 12:127508183-127508205 ATCCTCTCATGAGCTCTATGAGG - Intergenic
1106511663 13:30418513-30418535 ATCTGTGCATTTGCCCTCTGGGG - Intergenic
1106949136 13:34863227-34863249 ACCTGTGCATGATCTCTATGCGG - Intergenic
1107691298 13:42956329-42956351 ATTTGGTCATCAGCTCTTTGGGG - Intronic
1108271816 13:48769241-48769263 ATCTATTCAGGAGCTCTCCCTGG + Intergenic
1110060942 13:71037077-71037099 ATCTGTTCATGGGCTTTTTCTGG - Intergenic
1114388310 14:22278822-22278844 CCCTGATCATGAGCTGTCTGAGG + Intergenic
1115156451 14:30344975-30344997 AGGTGTTCATAAACTCTCTGAGG + Intergenic
1115829968 14:37326710-37326732 CTGTGTTCATGAGCTCATTGAGG + Intronic
1117933415 14:60872425-60872447 CTCTGTTAATCAGCTCTCTCTGG + Intronic
1122790298 14:104181542-104181564 ACCTGTACATGTGCCCTCTGGGG + Intergenic
1124887030 15:33696743-33696765 ATGTTTTCATGGGCTCCCTGGGG - Intronic
1126797145 15:52268703-52268725 TTCTGAACATGAGCTCTGTGTGG + Intronic
1128510849 15:68313257-68313279 ATCTGCCCATGAGCTCTCAGAGG + Intronic
1130624866 15:85503848-85503870 ATGTGTTCATGAATTCTCAGGGG + Intronic
1131358545 15:91768032-91768054 AAGTGTTCATGAGATCTGTGGGG - Intergenic
1131904541 15:97128714-97128736 ATCTCTTTCTGAGCTCTTTGAGG + Intergenic
1135129025 16:19836853-19836875 ATCTGGTCATGAGCCGTCTAGGG - Intronic
1140214269 16:72994865-72994887 ATCTCTTCAAGAGCTGCCTGTGG + Intronic
1141070610 16:80951253-80951275 ATCTGTTCTTGAGCTGTGTCAGG + Intergenic
1142188175 16:88704628-88704650 ATCTGTTACTGAGCGCTGTGAGG - Intronic
1149211266 17:54304185-54304207 ATCTTTTCATCATCTCTCTATGG + Intergenic
1149291643 17:55223620-55223642 TTCTGTCCTTGAGCTATCTGTGG - Intergenic
1150895996 17:69211600-69211622 ATCTGTTCCTGGACTCTTTGGGG + Intronic
1152785469 17:82245758-82245780 CTCTGTTCCAAAGCTCTCTGTGG + Intronic
1154077086 18:11214139-11214161 GTCTTTTTATGAGCTCTCTAAGG - Intergenic
1155195959 18:23474771-23474793 ATCAGTCCCTGAGCTCTCTATGG + Intronic
1155246169 18:23911616-23911638 AGCGCTTCTTGAGCTCTCTGTGG - Intronic
1158219372 18:55134459-55134481 ATCTTCTGATGGGCTCTCTGCGG + Intergenic
1158369596 18:56785151-56785173 ATCTGTTCAACAGCCCTATGTGG - Intronic
1158400541 18:57117486-57117508 AACTGTTCTTGGGCTCCCTGAGG + Intergenic
1158701406 18:59751440-59751462 ATTTGTTTATGAGTTGTCTGTGG - Intergenic
1159560559 18:69988460-69988482 TTCTGGTCATGAGCTTTCTCTGG - Intergenic
1160247394 18:77169662-77169684 ATCTGACCGTGAGCTCTCGGAGG + Intergenic
1160364005 18:78308863-78308885 ATCTGTCCACAAGCTCTCTATGG - Intergenic
1161179075 19:2867394-2867416 GTCCGTTCCTGAGCTCTTTGAGG - Exonic
1161715831 19:5875783-5875805 CTCTGTTCATGTCCTCGCTGGGG + Intronic
1162749794 19:12822066-12822088 ATCTGCACATGGCCTCTCTGTGG - Intronic
1164723592 19:30450732-30450754 ATCTGTTCATAAGGTCCCTCTGG - Intronic
1165176454 19:33934077-33934099 ATCTGTTGAACATCTCTCTGTGG - Intergenic
1168395117 19:56040885-56040907 ATCTCATCATGTCCTCTCTGGGG + Intronic
1202708987 1_KI270714v1_random:6151-6173 TTCTGTTCTTGGGGTCTCTGTGG - Intergenic
925036238 2:688590-688612 ATCTCCTCATGGTCTCTCTGAGG - Intergenic
925806187 2:7651167-7651189 TTCTGTTCATGAGTTCTATCTGG + Intergenic
927393251 2:22620202-22620224 ATATTTTCTTGAGCACTCTGGGG + Intergenic
927998268 2:27501848-27501870 TTCTGTGCATGAGCTGCCTGGGG + Intronic
929027445 2:37618267-37618289 TCCTGTTCCTGTGCTCTCTGTGG + Intergenic
929387495 2:41427031-41427053 TTCTGTACATGAGCCCTATGTGG - Intergenic
929705017 2:44201475-44201497 ATCTGCTCTTGAGCTTTCAGTGG + Exonic
933655634 2:84884738-84884760 ATCTGCTCCTGAGCTCTCTTAGG - Intronic
935425000 2:102910516-102910538 CTTTGTTCATGGGCCCTCTGGGG + Intergenic
941376634 2:164739388-164739410 ACCTGTGCATGAGATCTATGGGG + Intronic
941411543 2:165162701-165162723 AGCTGTTCATGGGCAATCTGAGG - Exonic
941684280 2:168431819-168431841 ATCTGCACATGAGCTGGCTGAGG - Intergenic
944818370 2:203403311-203403333 ATTTGTTCTTGCCCTCTCTGGGG - Intronic
946524881 2:220507701-220507723 ATCTGTTCCTGCCCTCCCTGTGG + Intergenic
948772199 2:240257341-240257363 ATCGATTCATGAGGTCACTGAGG - Intergenic
948936262 2:241166892-241166914 AGCTGGTCCTGTGCTCTCTGTGG - Intronic
1171362390 20:24597069-24597091 ATCTGTTCATGGACTCCCAGTGG - Intronic
1172441895 20:34971724-34971746 ATGTGTTCCTAAGCTCCCTGTGG - Intergenic
1173467223 20:43292855-43292877 ATTTGTACTTGAGCTCCCTGTGG - Intergenic
1175053554 20:56177310-56177332 ATCTGTTCATGAACTGGGTGAGG + Intergenic
1175545001 20:59772490-59772512 ATCTGATCATGGCCTCTCTAAGG + Intronic
1177181221 21:17746513-17746535 ATGTGTCCAGGAGCTCACTGAGG + Intergenic
1177518978 21:22192911-22192933 TTCTGTTGATGAGATCTCTCTGG + Intergenic
1180104045 21:45605576-45605598 ATGTGTTCTGGAGCTCTCTGTGG + Intergenic
1183324542 22:37184230-37184252 ATTTGTTCCTGAGCTCTCCCCGG - Intronic
951084576 3:18496353-18496375 AACAGTTCTTGAGCTTTCTGTGG - Intergenic
951723018 3:25721882-25721904 ATCAAATCATAAGCTCTCTGGGG + Intronic
954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG + Intronic
955342373 3:58135063-58135085 ATCTGGTCTTGAACTCTCTTGGG + Intronic
955625545 3:60914700-60914722 ATATGTTCATAAGCTATTTGTGG + Intronic
956115617 3:65915164-65915186 ATCCTTTCATGACCTCTGTGTGG - Intronic
956955711 3:74337176-74337198 CTCTTTTCATGAGCTCACAGGGG - Intronic
959294165 3:104514056-104514078 CTCCGGTCATGGGCTCTCTGTGG + Intergenic
961354475 3:126327340-126327362 CTCTGTTCAGGAGCTTCCTGGGG - Intergenic
962346869 3:134624959-134624981 ATATGTTCAGGAGGTGTCTGGGG + Intronic
963190452 3:142465561-142465583 ATCTTTTCAGGATCTTTCTGCGG + Intronic
965003415 3:162986881-162986903 ATCTGTAAATGAGTTTTCTGTGG + Intergenic
965758503 3:172050357-172050379 ATGTGTACATGTACTCTCTGTGG + Intronic
969874531 4:10126144-10126166 ATCTGATCATGAGGTCATTGGGG - Intergenic
970481746 4:16483108-16483130 TTCTGGTTATGAGCTCTCAGAGG - Intergenic
971342849 4:25786633-25786655 CTCTGTGTATGAGCTCCCTGAGG + Intronic
971396766 4:26235666-26235688 AGCTGTTCCAGAGCTCTCTGGGG + Intronic
971652954 4:29303594-29303616 ATCTGTACATGAGCCCCATGAGG + Intergenic
973719097 4:53705403-53705425 ATCTCTTCTGGAGGTCTCTGTGG - Intronic
974381477 4:61146152-61146174 GTCTTTTCATGAGTTCTCTGAGG - Intergenic
974733876 4:65902757-65902779 ATCTGTTCATGAACAATCTTTGG - Intergenic
975492966 4:75008719-75008741 AGCTGAGTATGAGCTCTCTGAGG + Intronic
977508169 4:97928946-97928968 ATCTGTACAGCAGATCTCTGTGG - Intronic
978630225 4:110735443-110735465 CTCAGTTCTTCAGCTCTCTGGGG + Intergenic
979742707 4:124171012-124171034 ATCTGTTCCTGGGCTTTTTGTGG - Intergenic
980380879 4:132014448-132014470 ATCTCTTCACCAGCTCTTTGGGG - Intergenic
981246771 4:142549843-142549865 CTTTGTTCCAGAGCTCTCTGAGG + Intronic
981624953 4:146744734-146744756 GTCTGTGTATGAGATCTCTGAGG + Intronic
982151969 4:152468926-152468948 ATCTGTTTAAGAGATCTCTGTGG + Intronic
982533805 4:156582881-156582903 TTCTGTTCATGAATTATCTGTGG + Intergenic
983487467 4:168349098-168349120 ATCTGGTCCTGGGCTCTTTGTGG + Intergenic
985894858 5:2743023-2743045 ATGTGTTTATTAGATCTCTGCGG - Intergenic
986758025 5:10855884-10855906 CCTTGTTCCTGAGCTCTCTGTGG + Intergenic
987043889 5:14088462-14088484 ATATTTTCATGTGCACTCTGAGG - Intergenic
987829156 5:23073871-23073893 ATCAGGCCATGAGCTCTCAGTGG - Intergenic
989701337 5:44268767-44268789 ATCTGTGCAAGAGATCTTTGAGG + Intergenic
990443713 5:55872504-55872526 CTCTGTTCAAGAGGTATCTGTGG + Intronic
992224892 5:74610740-74610762 ATCTGCTCCAGAGCTCCCTGTGG + Intergenic
992751654 5:79868115-79868137 ATCTGTTCCAGGGCTCTCTCTGG + Intergenic
992791902 5:80221100-80221122 AGCTGTTCATGAGCCCCCTTTGG - Intronic
994919242 5:106021130-106021152 ATCTATTGTTGAGCTTTCTGTGG + Intergenic
995183056 5:109246824-109246846 ATATGTTCATTAGCACTTTGTGG + Intergenic
996456084 5:123683303-123683325 ATCTGTTCTTCATTTCTCTGGGG - Intergenic
997871616 5:137510798-137510820 CTGTGTTCCTGAGCTCCCTGGGG - Intronic
998525172 5:142836215-142836237 CTCAGTTAATGATCTCTCTGGGG + Intronic
998529992 5:142875537-142875559 ACCTGATCAAGAGCTCTTTGAGG + Intronic
998645557 5:144057730-144057752 ATCTGGTCATGAGCTTTTTTTGG - Intergenic
998663097 5:144262858-144262880 ATCTGTTCATGAGCTCTCTGAGG + Intronic
1002984658 6:2177154-2177176 ATCCCTTCATAATCTCTCTGTGG - Intronic
1005350110 6:24925823-24925845 ATTTGTTAATGAGCTCACAGAGG + Intronic
1005677812 6:28173733-28173755 ATCTGTACATGAGGTCACTAGGG - Intergenic
1005973380 6:30778816-30778838 TTCTTTGCATGAGGTCTCTGGGG + Intergenic
1010075767 6:71795867-71795889 TTCTGTAGATGAGCTCTCTGTGG + Intergenic
1010579241 6:77573891-77573913 ATTTGTTTCTGAGCTCTATGAGG + Intergenic
1010579250 6:77573940-77573962 ATTTGTTTCTGAGCTCTATGAGG - Intergenic
1015445380 6:133297848-133297870 ATCTGTTCACCAGCTATGTGGGG + Intronic
1017230800 6:152071185-152071207 ATCAGATCATGAGGTCTTTGAGG - Intronic
1020657741 7:10947882-10947904 ATTTGTTCATGTTCTCTCTAGGG - Intergenic
1020869060 7:13605096-13605118 ATTTCTCCATGAGCTTTCTGTGG + Intergenic
1021330301 7:19329869-19329891 ATATTTTCCTTAGCTCTCTGAGG + Intergenic
1022533037 7:31078936-31078958 ATCTGTGTTTGAGGTCTCTGAGG + Intronic
1023035402 7:36127187-36127209 CTCTCTTCAAGAGCTCTCCGTGG - Intergenic
1023184291 7:37516791-37516813 ACTTGTACATGTGCTCTCTGGGG + Intergenic
1024150030 7:46562015-46562037 ATCTGTTCCTGGGCTTTCTTTGG - Intergenic
1026944695 7:74308078-74308100 ATGTGATCCTGAGGTCTCTGTGG + Intronic
1031270485 7:119643537-119643559 ATCTGTTCATCAGTTCTATGGGG - Intergenic
1031443322 7:121820840-121820862 ATCTGTTCAGGAGGCCTCTCTGG - Intergenic
1032848530 7:135772559-135772581 ATCTGTTCTTAAGATCTTTGAGG - Intergenic
1037677454 8:21064056-21064078 ATATGTCCATGAACTCTCTATGG + Intergenic
1038666492 8:29542135-29542157 ATCCATTCATAGGCTCTCTGCGG - Intergenic
1041024267 8:53667880-53667902 ATCTGTTGGTGAGGTCTCTGAGG - Intergenic
1042150909 8:65782985-65783007 ACCTGTTCTTGAAATCTCTGGGG + Intronic
1044549721 8:93498317-93498339 ATCTGACCATGAGCTCTTTAAGG + Intergenic
1045597998 8:103678800-103678822 ATCTATTCATGGACTATCTGGGG + Intronic
1046261547 8:111774897-111774919 AGCAGTTCATGAGAACTCTGGGG - Intergenic
1049045441 8:140147773-140147795 ATCTGTAAATTAACTCTCTGTGG - Intronic
1049398625 8:142414062-142414084 ATGTGTGCATGAGCTGTGTGTGG - Intergenic
1049796214 8:144498371-144498393 CTGTGTTCATGAGCTCTCCTGGG - Intronic
1050098356 9:2091862-2091884 ATCTTTTCATGTGCTTTCTCAGG + Intronic
1050622284 9:7466984-7467006 ATCTTTTAATGAACCCTCTGAGG - Intergenic
1051231517 9:14960200-14960222 AAATCTTCATGAGTTCTCTGAGG - Intergenic
1053447743 9:38165964-38165986 ATTTGTTCATGTACTGTCTGTGG + Intergenic
1056438721 9:86598587-86598609 ATCTGATTATGAGCCCTTTGGGG - Intergenic
1056819199 9:89825207-89825229 ATGTGTGACTGAGCTCTCTGTGG + Intergenic
1057999597 9:99851429-99851451 TCCTTTTCATGAGCTCTCTGTGG - Intronic
1058581958 9:106467979-106468001 ATCTGTGGCTGAGCTGTCTGCGG - Intergenic
1059853684 9:118371591-118371613 ATCTGTTTATGAGTTCTCCTTGG + Intergenic
1059916623 9:119110413-119110435 TTCTTTTGATGAGCTCTCTGAGG + Intergenic
1061414172 9:130437169-130437191 ATCTGTTCATGGGTCCTCCGGGG - Intergenic
1062323570 9:136002346-136002368 ATCCGTTCATGGGCTCTGGGTGG + Intergenic
1062546663 9:137066621-137066643 ATCGGTCCGTGAGCTCTCTGGGG + Intronic
1186240972 X:7565976-7565998 ATGTTTTCTTGAGCTCTCTTTGG + Intergenic
1186420510 X:9421879-9421901 ATCTGTACATGAGCTGTGAGGGG + Intergenic
1187020328 X:15374884-15374906 ATCTCTTCATGAGCTTTATGAGG - Intronic
1187098703 X:16170681-16170703 ATCTCTTCCTGTGCTCTCAGAGG - Exonic
1187552192 X:20317214-20317236 TTCTATTCATGACCTCTCTCAGG - Intergenic
1187810321 X:23169082-23169104 ATCGGTTCATGAACCCTTTGAGG + Intergenic
1200440422 Y:3206192-3206214 CTTTATTCATGAGCTCACTGGGG + Intergenic