ID: 998669489

View in Genome Browser
Species Human (GRCh38)
Location 5:144337796-144337818
Sequence CATAGTGAAGGGAGAAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 386}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998669484_998669489 -7 Left 998669484 5:144337780-144337802 CCCTGATCTATCTATACATAGTG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 998669489 5:144337796-144337818 CATAGTGAAGGGAGAAGAGTGGG 0: 1
1: 0
2: 2
3: 39
4: 386
998669482_998669489 20 Left 998669482 5:144337753-144337775 CCATTACCATTTTTTTAGAGAGA 0: 1
1: 1
2: 5
3: 44
4: 514
Right 998669489 5:144337796-144337818 CATAGTGAAGGGAGAAGAGTGGG 0: 1
1: 0
2: 2
3: 39
4: 386
998669483_998669489 14 Left 998669483 5:144337759-144337781 CCATTTTTTTAGAGAGAGTAGCC 0: 1
1: 0
2: 0
3: 9
4: 225
Right 998669489 5:144337796-144337818 CATAGTGAAGGGAGAAGAGTGGG 0: 1
1: 0
2: 2
3: 39
4: 386
998669485_998669489 -8 Left 998669485 5:144337781-144337803 CCTGATCTATCTATACATAGTGA 0: 1
1: 0
2: 0
3: 6
4: 90
Right 998669489 5:144337796-144337818 CATAGTGAAGGGAGAAGAGTGGG 0: 1
1: 0
2: 2
3: 39
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998669489 Original CRISPR CATAGTGAAGGGAGAAGAGT GGG Intronic
900677378 1:3896316-3896338 CCCAGTGAACGGAGAAGACTGGG + Intronic
902353995 1:15882823-15882845 CAGAGTGATGGCAGAAGAGTAGG + Intronic
903080816 1:20810862-20810884 CACTCTGAAGGTAGAAGAGTCGG + Exonic
904417317 1:30371287-30371309 CACATTGCAGGGAGGAGAGTGGG - Intergenic
905604147 1:39282130-39282152 CATAATGTATGGAGAAGAGAAGG + Intronic
906362902 1:45179443-45179465 CATAGGGAAGGGAGAGGGTTAGG + Intronic
906492679 1:46280358-46280380 AATGGTGAAGGGAGAGGAGTAGG - Intronic
907377452 1:54055483-54055505 CCTAGTGGAGGAAGAAGAATTGG - Intronic
908766561 1:67559674-67559696 CTTGGAGCAGGGAGAAGAGTAGG + Intergenic
909754860 1:79212554-79212576 AATGGTGAAGGAAGTAGAGTAGG - Intergenic
912321720 1:108719987-108720009 CAGAATGTAGGGAGAAGAGAGGG + Intronic
912570891 1:110620201-110620223 CAGAGGGAAAGGAGAAGAGAGGG - Intronic
912741007 1:112197394-112197416 CACACTGAGGGTAGAAGAGTTGG - Intergenic
914698193 1:150105168-150105190 CATACTGAATGGGGAAAAGTTGG + Intronic
914901305 1:151712531-151712553 CAGGGTGAAGGGGGAAGAGCTGG + Intronic
915560349 1:156683475-156683497 CATGGTGAAGGGAGGAGCATCGG + Intergenic
915964129 1:160291760-160291782 CCTAGTGAAGGGTGAAGGGAAGG + Intronic
916204666 1:162304185-162304207 CAGAGAGAAGGAAGAAGAGAAGG - Intronic
916253838 1:162766230-162766252 CATAGTGAAGAGAGTATATTTGG - Intronic
916822743 1:168415525-168415547 CAGAGTGCAGGTGGAAGAGTTGG - Intergenic
917105569 1:171487766-171487788 AATAGTGGAGGGAGAATGGTAGG + Intronic
917147621 1:171909622-171909644 GATAGTCAAGAGAGAAGAGGTGG - Intronic
917583644 1:176402802-176402824 CATAGTGAATGGGCAAGAGCTGG + Intergenic
917921632 1:179755518-179755540 CTCAGTGAGTGGAGAAGAGTTGG + Intronic
918332991 1:183477260-183477282 AATAGTGAAGGAAGAAAAGGAGG - Intronic
918503120 1:185220516-185220538 CAAACTGAAGGGGGAAAAGTAGG - Intronic
919245450 1:194977506-194977528 CCTACTTGAGGGAGAAGAGTGGG - Intergenic
920056614 1:203197508-203197530 GATACTGAAGGGAGAGGAGAAGG - Intergenic
921290346 1:213651074-213651096 CAGAGTGTAGGGAGAAAAGTGGG + Intergenic
921320772 1:213936281-213936303 CATAGATAAGTGAGAAGAGTGGG + Intergenic
921329377 1:214020212-214020234 AATAGTGAGGGGGGCAGAGTGGG - Intronic
921352048 1:214245806-214245828 TATAGTTAAGTGAGAAAAGTAGG + Intergenic
921840204 1:219820297-219820319 CATAGTGCAGGGAAAAGAACTGG - Intronic
923603550 1:235423722-235423744 CAAATGGAAGGGAAAAGAGTCGG - Intronic
1063220913 10:3966968-3966990 CATGGTGGAGGGAGAAGAGAGGG - Intergenic
1063333703 10:5188305-5188327 CACTGTGAAGGGAAAAAAGTAGG + Intergenic
1063694829 10:8324216-8324238 CATTGTGGAGGGAGAAGAAGGGG - Intergenic
1066373309 10:34835885-34835907 CATGGTGAAGGAAAATGAGTAGG - Intergenic
1067343705 10:45423223-45423245 CAGAGTCAAGGCTGAAGAGTGGG + Intronic
1067429094 10:46231182-46231204 CCTAGTGAAGGGAGAAAAGGGGG - Intergenic
1067859884 10:49835021-49835043 CCTAGAGAAGGGAGAAGCCTGGG - Intronic
1070586553 10:77771092-77771114 GAAAGAGAAGGGAGGAGAGTGGG + Intergenic
1073044583 10:100629162-100629184 CATAACAGAGGGAGAAGAGTGGG - Intergenic
1073103302 10:101018376-101018398 CAGAGAGAAGGGAGAGGAGAGGG + Intronic
1074118697 10:110477179-110477201 CATGGTGAAGAGATTAGAGTTGG - Intergenic
1074383382 10:112998051-112998073 GAGAGTGAAGGGAGATGAGGTGG + Intronic
1074706383 10:116136480-116136502 CAAAGTGGAGGGGGAAGAGGGGG - Intronic
1075388964 10:122078483-122078505 CACAGTGAAGGGAGAAGCATGGG - Intronic
1075680160 10:124325768-124325790 CAGAGTGACGGGAGCAGTGTGGG - Intergenic
1075795402 10:125116425-125116447 CAGAGTGTGGGGAGAAGGGTGGG - Intronic
1077412287 11:2409282-2409304 CAGAGTGCAGGGAGGAGAGGGGG - Intronic
1077889922 11:6411447-6411469 CTTAGTGCAGGGAGATGAGGAGG - Intronic
1078349020 11:10577271-10577293 GAGAGTGAAGGAAGAAGAGGAGG - Intronic
1078383057 11:10861417-10861439 CAGAGTGATGGCAGAAGAATTGG - Intergenic
1079511848 11:21219924-21219946 CATAGTGGAAGGTGAAGAGATGG + Intronic
1079797262 11:24820809-24820831 CATAGTGTAAGAAGAAGACTTGG + Intronic
1079986295 11:27203864-27203886 CTTAGAGAAGGTAGAAGAGCAGG + Intergenic
1081010083 11:37800251-37800273 CATACTGAAGGGGCAAGAGCTGG + Intergenic
1081202898 11:40239607-40239629 CATTACTAAGGGAGAAGAGTTGG - Intronic
1081244779 11:40751160-40751182 CATAATCAAGGGGGAAAAGTTGG + Intronic
1081416839 11:42825809-42825831 TATAGTGAAGGGAGGGGAATGGG + Intergenic
1081579454 11:44342161-44342183 CATTGTAAAGTGAAAAGAGTAGG + Intergenic
1081648943 11:44810318-44810340 CATAGAGAAGGAAGAGGAATTGG - Intronic
1082649816 11:55776006-55776028 TATAGGGAAGGGAAAAGAGTAGG + Intergenic
1082857269 11:57819473-57819495 CAGAAGGAAGAGAGAAGAGTAGG - Intronic
1083058089 11:59842444-59842466 TACATTGAAGGGAGAGGAGTTGG + Exonic
1083260763 11:61521659-61521681 CACAGGGAAGGGAGCTGAGTTGG - Intronic
1085156366 11:74298668-74298690 CACAGGGAAGGGAGGAGACTTGG + Intronic
1085551066 11:77372692-77372714 AATAGTGAAGGAAGTAGAGGTGG - Intronic
1086227441 11:84529186-84529208 CATACTGAATGGACAAAAGTTGG + Intronic
1086438738 11:86807241-86807263 CATCATGAAGGTAGAAGAGGAGG + Intronic
1086680863 11:89670123-89670145 CATAGAGGAGGGAGAAGTGGGGG - Intergenic
1086750923 11:90492401-90492423 CTTAGTGAGGGGAGAGGAATTGG - Intergenic
1086834846 11:91607891-91607913 CATGGTGAAGGGTGAAGATGAGG - Intergenic
1086896549 11:92319873-92319895 AATAGTTATGGGAGAGGAGTAGG + Intergenic
1087614461 11:100472022-100472044 CATAGCGAAGAGACATGAGTGGG + Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1088005415 11:104933541-104933563 CATAGTGAATGGGGAAAAGGTGG + Intergenic
1089357364 11:117862615-117862637 CTTGGTGAAGGAAGAAGATTGGG - Intronic
1089829002 11:121308470-121308492 AAAAGTGAGGGGAGAAGAGGAGG - Exonic
1090278961 11:125439943-125439965 CAAAGTGAAGTGGCAAGAGTGGG - Intergenic
1090437378 11:126697884-126697906 GAGAGTGAAGGAAGAAGAGAGGG + Intronic
1090690142 11:129172267-129172289 CATATTGAATGGAGAAAAGATGG - Intronic
1091838346 12:3601799-3601821 CTCTGTGAGGGGAGAAGAGTGGG + Intergenic
1091873398 12:3913776-3913798 GAAAGGGAGGGGAGAAGAGTAGG - Intergenic
1092120944 12:6043448-6043470 CAAAGTGAATGGTGAGGAGTTGG - Intronic
1092653665 12:10662014-10662036 GCTAGGGAAGGGAGCAGAGTAGG - Intronic
1092758591 12:11788628-11788650 AAGAGTGAAGGGAGGGGAGTGGG - Intronic
1092897941 12:13031805-13031827 CACAGTTCAGGGAGAAGAGGAGG - Intergenic
1093032468 12:14301043-14301065 CATAGTGAATGGACAAAAGCTGG + Intergenic
1095680259 12:44966429-44966451 CAAAGTGAAGAGAAAAGAATAGG + Intergenic
1097282685 12:57854383-57854405 CATTTGGAAGGGAGAAGAGGAGG + Intergenic
1098267682 12:68739001-68739023 TATAGTGATGGGAGAGCAGTAGG - Intronic
1098969971 12:76842849-76842871 CATAGTGGTGGCAAAAGAGTTGG + Intronic
1099064162 12:77952696-77952718 CATAGGGAAGGGAGAAGCAGAGG - Intronic
1099085918 12:78245796-78245818 AATAGTAAAGGGTGAAGAATTGG - Intergenic
1099262482 12:80400597-80400619 CCTTGGGAAGGGAGAGGAGTGGG - Intergenic
1099406388 12:82268613-82268635 CATAGGGTAGGGAGAGTAGTAGG + Intronic
1099560531 12:84168092-84168114 CATAGTGAGGGGTAAAAAGTTGG + Intergenic
1099828510 12:87810542-87810564 TATAGGGAAAGGAGAAGAGATGG - Intergenic
1099868408 12:88314962-88314984 CCTACTTGAGGGAGAAGAGTGGG - Intergenic
1100916673 12:99431784-99431806 CATAGTCCAGGGAGAAGAATAGG - Intronic
1101327551 12:103729191-103729213 CCTAGTGGAGGGTGGAGAGTGGG + Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1101719654 12:107340474-107340496 CACAGGGAAGGGGGAAGAGATGG - Intronic
1102704715 12:114870949-114870971 CATAGTGAGTGGAGAAGAGAAGG - Intergenic
1103217411 12:119212672-119212694 GATAGTGAAAGGAGACCAGTGGG + Intronic
1105326086 13:19371571-19371593 CATAGAGAAGGGTGTAGAGAAGG - Intergenic
1105573059 13:21622390-21622412 CTTTATGAAGGGAGAAGAGATGG + Intergenic
1106203551 13:27566604-27566626 CAGATTTAAGGGAGGAGAGTTGG + Intronic
1106792942 13:33174521-33174543 CATGGTAAAGGGAAAAGAGCAGG - Intronic
1107123231 13:36818288-36818310 CATATGGAAGGGAGAAGGTTTGG - Intergenic
1108611045 13:52084021-52084043 CAGAGTTAAAGGAGGAGAGTGGG - Intronic
1110756069 13:79175718-79175740 TATACTGAATGGAGAAAAGTTGG + Intergenic
1110799600 13:79679575-79679597 CAGAGTGAAGGGGAAAGAATAGG + Intergenic
1113202256 13:107879266-107879288 CATACTGAATGGACAAAAGTTGG + Intergenic
1113580437 13:111425016-111425038 AATCCTGAGGGGAGAAGAGTTGG + Intergenic
1114362355 14:21988786-21988808 CAAAGTGAATGGAGAAGTGTTGG + Intergenic
1114899140 14:27034102-27034124 CATAGCAAAAGTAGAAGAGTCGG - Intergenic
1115378433 14:32705341-32705363 CATTGGGAAGGGAAGAGAGTGGG + Intronic
1115518109 14:34205807-34205829 CAAGGTGGAGGGAGAAGAGTTGG - Intronic
1115960405 14:38830137-38830159 GAGGGTGAAGGGTGAAGAGTGGG + Intergenic
1116348395 14:43827199-43827221 CATATTGGAGGGTGAAGGGTGGG - Intergenic
1116575373 14:46567805-46567827 CCTATTGAAGGGTGGAGAGTAGG - Intergenic
1118063607 14:62166927-62166949 CATAGAGAAGGGAACAGAGCAGG + Intergenic
1118527255 14:66660774-66660796 CACAGAGAATGGAGAAGAGCAGG + Intronic
1119125021 14:72117434-72117456 CATGGTGAAAGGTGAAGGGTGGG - Intronic
1119148943 14:72340587-72340609 CAAAGTGAAGGGAGAGGGGAGGG + Intronic
1119990810 14:79195175-79195197 CCCAGTGAAGGGAGAAAACTGGG + Intronic
1120336098 14:83157058-83157080 CCTATTTAAGGGTGAAGAGTGGG + Intergenic
1120782843 14:88501578-88501600 CATACTTAAGGCAGATGAGTGGG + Intronic
1120941192 14:89951438-89951460 CAAAGTGAAGGGAGCAAAGAAGG - Intronic
1121032076 14:90666796-90666818 CACAGTGAGAGGAGTAGAGTGGG + Intronic
1122516928 14:102315366-102315388 TATAGGGAACGGAGAAGATTAGG - Intergenic
1124587923 15:31026272-31026294 CTGTGTGAAGGGAGAAGTGTCGG + Intronic
1125915238 15:43480961-43480983 GGAAGAGAAGGGAGAAGAGTTGG - Exonic
1126705623 15:51402448-51402470 CATAGAGGAGGCACAAGAGTTGG - Intronic
1127462930 15:59216159-59216181 CCTAGTCAAGGGACAACAGTGGG - Intronic
1128650040 15:69404377-69404399 CCTAGTGAAGGGAGAACAGAAGG + Exonic
1128680444 15:69647706-69647728 CATGGGGAAGGGAGATGAGAGGG + Intergenic
1129001809 15:72341660-72341682 CTAGGTGAAGGGAGATGAGTTGG + Exonic
1129612463 15:77071332-77071354 CATAGTCATAGGAGGAGAGTGGG - Intronic
1129656878 15:77530250-77530272 CAGAGGAATGGGAGAAGAGTGGG - Intergenic
1131406793 15:92171658-92171680 TGCAGTGAAGGGACAAGAGTAGG - Intronic
1132180161 15:99746647-99746669 CAGAGTGAAGACAGAAGAGAAGG + Intergenic
1133462497 16:5999539-5999561 AAGAGTGAAGGAAGAAGGGTTGG + Intergenic
1133894041 16:9908614-9908636 GAGAGTAAAGGGAGAAGTGTGGG + Intronic
1133909637 16:10053147-10053169 AACAGTGAATGGAGAAGAGTAGG + Intronic
1133916010 16:10110565-10110587 CATGGGCAAGGGAGAAAAGTGGG + Intronic
1136070462 16:27784312-27784334 GATAGGGAAGGGGAAAGAGTTGG - Intergenic
1138392877 16:56682996-56683018 CAAAATGAAGGGAGAGGAGATGG + Intronic
1139910408 16:70394157-70394179 CGTGAGGAAGGGAGAAGAGTTGG - Intronic
1143690405 17:8558353-8558375 CATAGAGAAAGGAGGAGAGAAGG + Intronic
1143887806 17:10078410-10078432 GCTAGTGAAGAGAGAAGAATTGG + Intronic
1143973189 17:10810705-10810727 AAGAGGAAAGGGAGAAGAGTTGG - Intergenic
1146009822 17:29184990-29185012 CATGGTGTAGGGAAAAGAATGGG - Intergenic
1146054374 17:29573868-29573890 CATAGAGAAGGGGCGAGAGTGGG + Exonic
1147759859 17:42790529-42790551 GAGAGTGAAGGGAGATGAGCCGG + Intronic
1148483441 17:47975492-47975514 CCTAGAGAGGGGAGAAGAGGTGG - Exonic
1149092915 17:52805159-52805181 CACAGTGAAGAGAGATAAGTTGG - Intergenic
1149336828 17:55644141-55644163 CCTAGAGAAGGGAGAAGGGAAGG - Intergenic
1149853016 17:60052641-60052663 AATTGTGAAGGGAAAAGAATAGG + Intronic
1150190049 17:63229027-63229049 CATAATGAATGGGGAAGAGCTGG - Intronic
1151160624 17:72162132-72162154 AATATAGAAGGGAGAAGAGAAGG + Intergenic
1152975494 18:213494-213516 CTTTGAGAAGGGAGAGGAGTAGG + Exonic
1153742908 18:8147744-8147766 CATAGTGAATGGGCAAAAGTTGG - Intronic
1155540741 18:26865471-26865493 CATAGAGAAGGTAGAAGAAAAGG - Intronic
1156339192 18:36196062-36196084 AACACGGAAGGGAGAAGAGTGGG + Intronic
1156776405 18:40794112-40794134 CATACTGAATGGAGAAAAGCTGG + Intergenic
1156802363 18:41131945-41131967 CAGAGAGAAGGGAGAAGAGATGG + Intergenic
1156934484 18:42686717-42686739 CCTATTGAAGGGTGAAGGGTGGG + Intergenic
1157480671 18:48051594-48051616 CAAAGTGATGGGATGAGAGTGGG + Intronic
1157742632 18:50106937-50106959 CTTAGTGAAGGCAGCAGAGTGGG - Intronic
1158135580 18:54204160-54204182 CATAGTGGAGGGAGAAGTAGGGG - Intronic
1158511261 18:58092574-58092596 TAGAGTGAATGGAGATGAGTAGG + Intronic
1160008992 18:75089517-75089539 CATAGTGAAGGAAGCAGGGATGG - Intergenic
1162115853 19:8428986-8429008 CAGAGTGTAGGGAGAAAAGTGGG + Intronic
1164258610 19:23550467-23550489 CATAGTGAAGTTTGAAGAGAAGG - Intronic
1164397463 19:27878514-27878536 AAAAGTGAAGGAGGAAGAGTAGG - Intergenic
1164690205 19:30205224-30205246 AAAAGTGAAGGGAGGAGAGAAGG + Intergenic
1165306004 19:35003417-35003439 CAGAGTGAAGGGAGGAGCCTGGG - Intronic
1165636441 19:37344180-37344202 CATAGGGGAGGGAGGAGAGAGGG + Intronic
1165981212 19:39725965-39725987 CAAAGTAAAGGGAGAAGAGAAGG - Intergenic
1167633921 19:50642442-50642464 CATAGAGAGGGGAGCAGAGCTGG - Intronic
1167680135 19:50914686-50914708 GAGAGCGAAGGGAGAAGTGTTGG - Intergenic
1167763853 19:51466790-51466812 CATAGTAAATGGAGTAGTGTAGG + Intergenic
1167903125 19:52637218-52637240 CACAGAGATGGGAGAAGAGGCGG - Intronic
1167934143 19:52892689-52892711 CACAGAGATGGGAGAAGAGGTGG - Intronic
926351737 2:12001696-12001718 TAGAGTGAATGGAGAAGAGTAGG + Intergenic
928270907 2:29853792-29853814 CCAAGTGAAGAGAGAAGAGGAGG - Intronic
930126084 2:47797981-47798003 CATTATGAAGGAAGCAGAGTGGG - Intronic
930834256 2:55776209-55776231 CATAATGAAGAGACAATAGTTGG + Intergenic
931308715 2:61057890-61057912 GAAAGTGCAGGGAGAAGAGAGGG - Intergenic
931322253 2:61182502-61182524 CAGAGGGAAGGAAGAAGAGAGGG - Intronic
932398466 2:71463941-71463963 CATCTTGAGGGGAGAAGAGAAGG + Intronic
932482533 2:72054997-72055019 CATAGCGAAGGGTGGAGTGTGGG - Intergenic
933507434 2:83196192-83196214 TATAGTGGAGGTAGGAGAGTAGG + Intergenic
933588314 2:84203704-84203726 CATTGTGAAGGGAGAATTTTTGG - Intergenic
935351015 2:102151920-102151942 AACAGTGAAGGCAGAAGAGTAGG + Intronic
935475143 2:103510507-103510529 TATATTGAATGGAGAAAAGTTGG - Intergenic
937300955 2:120841359-120841381 CCTAGTGAAGAGAGAGGAGAGGG + Intronic
939177711 2:138768942-138768964 CAGAGTGGAGGGAAAAGCGTAGG - Intronic
939289515 2:140176002-140176024 GAAAGGGAAGGGAGAATAGTGGG - Intergenic
939677275 2:145088151-145088173 CATAGGGAAGGGAGAGGTGCCGG + Intergenic
939778216 2:146412241-146412263 AATAAAGAAGGGAGAAAAGTAGG + Intergenic
941035745 2:160567567-160567589 CACAGTGTAGGGTGAAGAGCAGG - Intergenic
942375890 2:175337125-175337147 CACACTGAATGGAGAAAAGTTGG - Intergenic
942418106 2:175779947-175779969 GAGAGTGAAAGGTGAAGAGTTGG + Intergenic
942462812 2:176180286-176180308 AATAGAGGAGGGAGAAGAGAAGG + Intergenic
942489904 2:176479310-176479332 CATAGTGTAGGGATAACTGTTGG - Intergenic
942518766 2:176781266-176781288 CAAAGTGAAGGGCAATGAGTTGG - Intergenic
943687265 2:190831620-190831642 CAAAATGAAGGATGAAGAGTAGG + Intergenic
944102798 2:196046678-196046700 CATCTTGAAGGGAGGACAGTGGG - Intronic
944602441 2:201317091-201317113 CATACTGAATGGGGAAAAGTTGG + Intronic
944890872 2:204116038-204116060 CATAAAGAAGGGAGGAGAATGGG - Intergenic
945221727 2:207490457-207490479 CATTGTGAAGGGAGTGGAGAGGG + Intergenic
945318323 2:208393859-208393881 AAGAGTGAAGGGGGGAGAGTAGG + Intronic
946003987 2:216507360-216507382 CCTAGAGCAGGGGGAAGAGTAGG + Intronic
946355999 2:219185326-219185348 CAGGCTGAGGGGAGAAGAGTTGG + Exonic
946411356 2:219516828-219516850 CATTGTGCAGGGAGAAGAGTCGG + Intronic
948796824 2:240408117-240408139 CACAGTGAAGCTACAAGAGTTGG + Intergenic
948923041 2:241075136-241075158 CACAGAGAGGGGAGAAGAGCCGG - Intronic
1169052604 20:2593635-2593657 CAAAGTGAAGGTAAAAGAGATGG - Intronic
1169251408 20:4064042-4064064 AAATGTGAAGGGAGAAGAGGAGG + Intergenic
1169276230 20:4235406-4235428 AAGAGAGAAGGGAGAAGAGGAGG - Intronic
1170998133 20:21385686-21385708 CCAAGTGAAGGGAGGAGAGTGGG + Intronic
1172854218 20:37988882-37988904 CAGAGTGATGGGAGAAGAGATGG - Intronic
1173082187 20:39878844-39878866 CATAGTGAGGAGAGAAGTTTGGG - Intergenic
1174518036 20:51108378-51108400 CATACTGAAGTGAGAATAGCAGG + Intergenic
1174906213 20:54554475-54554497 CATAATGGATGGTGAAGAGTTGG - Intronic
1175312026 20:58018783-58018805 CATGGAGCAGGGAGAAGAGCTGG - Intergenic
1180661821 22:17474373-17474395 GGTAGGTAAGGGAGAAGAGTTGG + Intronic
1182191593 22:28466729-28466751 AGTAGTGAAGGGTGAAGGGTGGG - Intronic
949136291 3:570381-570403 GATAGTAAGGGGAGAAGAGATGG + Intergenic
949313987 3:2731288-2731310 TAAAGGGAAGGGAGAAGACTAGG - Intronic
950167200 3:10810401-10810423 TATAGGGAAGGGTGAAGAATTGG + Intergenic
950796124 3:15511943-15511965 CCTAGTGAAGTAAGAAGAGCAGG + Intronic
950813529 3:15673815-15673837 AGTAGAGAAAGGAGAAGAGTAGG + Intronic
951860315 3:27244748-27244770 CACAGGGAAGGGAGAAGAGGGGG - Intronic
953395860 3:42569236-42569258 GATAATGAAGGGAGGAAAGTTGG - Intronic
953791297 3:45950111-45950133 CAAATGGAAGGGAGAAGGGTGGG - Intronic
954287167 3:49627085-49627107 CATAGTGTTTGGTGAAGAGTGGG + Intronic
955470301 3:59279677-59279699 AGTAGAGAAGGGAAAAGAGTGGG - Intergenic
956991505 3:74771724-74771746 GATGGGGAAGGGAGGAGAGTGGG + Intergenic
957107986 3:75915723-75915745 AATGGTGTAGAGAGAAGAGTGGG + Intronic
957332043 3:78777933-78777955 CATAGTGAATGGACAAAAGCTGG - Intronic
958108880 3:89114059-89114081 CATGGTGAAGTGAGAATAATAGG + Intronic
958155955 3:89756076-89756098 CATACTGAAGGGGCAAAAGTGGG + Intergenic
958688304 3:97427530-97427552 CCTACTGGAGGGTGAAGAGTGGG + Intronic
959372961 3:105552198-105552220 GATAGTCAAGGAAGAAGAGTCGG - Intronic
959399124 3:105877713-105877735 CATAGGGAATGAAGAAGTGTAGG - Intergenic
960459378 3:117914430-117914452 CTTAGTGACTGGAGAAGAATGGG + Intergenic
961502008 3:127342871-127342893 CAATGTGAAGGGGGAAGAGTAGG + Intergenic
961522765 3:127476749-127476771 AAGAGGGAAGGGAGAAAAGTAGG + Intergenic
961969036 3:130939856-130939878 AATAGTGGAGGTAGAAGGGTTGG - Intronic
963127264 3:141827450-141827472 CATAGAGAAGGGACATGAGCAGG + Intergenic
964225905 3:154401523-154401545 ATTAGTGAAAGTAGAAGAGTTGG + Intronic
964682867 3:159361712-159361734 CACAGTGGGAGGAGAAGAGTTGG + Intronic
965134922 3:164751818-164751840 CCTAGTGAAGGGAAAGCAGTAGG - Intergenic
966679807 3:182629860-182629882 GAGTGTGAAGGCAGAAGAGTTGG + Intergenic
967400992 3:189060335-189060357 CATACTGAATGGAGAAAAGCTGG + Intronic
967533261 3:190573234-190573256 GATAATGAAGGAAGAAGAGATGG + Intronic
967716016 3:192762436-192762458 CATACTGAATGGACAAAAGTTGG + Intronic
967793543 3:193574240-193574262 CGTAGTGAAGGAAGGAAAGTAGG + Intronic
969226269 4:5800532-5800554 CCTGGTGAAGGGAGGAGAGGTGG + Intronic
969473559 4:7405936-7405958 TATACTGAATGGAGAAAAGTTGG - Intronic
971056493 4:22919229-22919251 CATAGTGGAGGGTGGAGAGTGGG - Intergenic
971517016 4:27499846-27499868 CATATTGAAGGGGCAAAAGTTGG + Intergenic
972153225 4:36122596-36122618 CCTAATGGAGGGTGAAGAGTGGG + Intronic
972226756 4:37022090-37022112 CATAGTGAAAGGAGGAGGGCTGG + Intergenic
972600755 4:40570170-40570192 AATGGTGAAGGGAGAAGTGATGG + Intronic
972810038 4:42573772-42573794 CAGAGTGAGTGGGGAAGAGTGGG + Intronic
974104217 4:57450016-57450038 CATACTCAATGGAGAAGAGTTGG - Intergenic
976040893 4:80884015-80884037 CATACTGGAGGGTGAAGGGTGGG - Intronic
977148270 4:93474716-93474738 CATAGGGAAGGGAGAAAACCAGG - Intronic
978701642 4:111653644-111653666 AATAGGGAAGGGAGGAGAGGGGG + Intergenic
980106230 4:128591337-128591359 GAAAAGGAAGGGAGAAGAGTGGG - Intergenic
980346193 4:131623194-131623216 GATAGTGATGGGAGAATAATGGG - Intergenic
981219061 4:142210482-142210504 CAAAGAGAAGGTAGAAGATTGGG + Intronic
981863147 4:149381291-149381313 TAGACTGAAGGGAGAAGAGGAGG - Intergenic
982632909 4:157854847-157854869 CATAGTGAATGGGCAAAAGTTGG - Intergenic
983416131 4:167457415-167457437 AAAAGTGAAGGGAAAAGAATTGG - Intergenic
983515201 4:168648351-168648373 CATAATGAAGGGGGAAAAATGGG + Intronic
983958098 4:173720522-173720544 CATACTGAATGGACAAAAGTTGG + Intergenic
985289018 4:188367890-188367912 CTTGGAGAAGGGAGCAGAGTTGG - Intergenic
985393295 4:189514460-189514482 CAGGGTGAAGGGAGCAGAGGAGG + Intergenic
985910896 5:2881322-2881344 GAGAGTGGAGGGAGGAGAGTGGG + Intergenic
986004724 5:3658139-3658161 CAGAGAGAAAGGAGAAGAGGAGG - Intergenic
986411100 5:7480594-7480616 CCTATTGGAGGGTGAAGAGTGGG + Intronic
987080751 5:14423292-14423314 GAGAGTGAAGGGAGGTGAGTGGG - Intronic
988008647 5:25453588-25453610 CTTGGAGAAGGGAGTAGAGTGGG + Intergenic
988088421 5:26502842-26502864 CATATTGGAGGGTGAAGAGTGGG + Intergenic
989593533 5:43134461-43134483 TATATTGAAGTGATAAGAGTAGG - Intronic
990131828 5:52595575-52595597 CATGGTGAAAGCAGAAGAGAGGG - Intergenic
992244222 5:74801890-74801912 CATAGTGAAGGGAGAGCATGTGG - Intronic
993045350 5:82860105-82860127 CATACTCAAAGGAGAAGAGCAGG - Intergenic
993335838 5:86657499-86657521 TACAAAGAAGGGAGAAGAGTGGG - Intergenic
993793313 5:92234245-92234267 CATACTGAATGGACAAGAGCTGG - Intergenic
994241657 5:97429461-97429483 CAGGGTGAATGGAGAAGAGAGGG + Intergenic
994360840 5:98846542-98846564 CACACTGAAGGGTGAGGAGTAGG + Intergenic
995427093 5:112037411-112037433 CATACTGAAGGGACAAAAGCTGG + Intergenic
995641035 5:114257940-114257962 CATACTGAATGGAGAAAAGCTGG - Intergenic
995816725 5:116177692-116177714 CAAAGGTAAGGGAGAAGAGAAGG - Intronic
996363977 5:122680406-122680428 CAGAAGGAAGGGAGAAGAGGAGG - Intergenic
996958233 5:129211106-129211128 CATACTGAATGGGGAAAAGTTGG + Intergenic
997895532 5:137712667-137712689 CATCTTGAGGGGAGAAAAGTAGG + Intronic
998555366 5:143118040-143118062 CCCAGTGAAGGCAGAAGTGTTGG - Intronic
998669489 5:144337796-144337818 CATAGTGAAGGGAGAAGAGTGGG + Intronic
998789254 5:145748051-145748073 CATATTGAAGGGACAAAAGCTGG + Intronic
999232415 5:150069602-150069624 TAGAGTGCAGGGACAAGAGTGGG + Intronic
999969753 5:156847521-156847543 CATAGATAAAGGAGGAGAGTGGG + Intergenic
1000380114 5:160621344-160621366 CAGTGTGTAGGGAGTAGAGTTGG + Intronic
1000428876 5:161126501-161126523 AATACTAAAGGGAGAAGGGTGGG + Intergenic
1000486772 5:161855794-161855816 CATAGGGTAGGGAGGAGATTAGG - Intronic
1001248590 5:170125593-170125615 CAAAGTGCTTGGAGAAGAGTAGG + Intergenic
1002874489 6:1199548-1199570 CCCAGGGAAGGGAGATGAGTGGG + Intergenic
1002961392 6:1918139-1918161 GATAGAGAGGGGAGAAGAGAAGG + Intronic
1003277521 6:4665145-4665167 CATAGAGAAAAGAGAAGAGCAGG - Intergenic
1004872652 6:19922803-19922825 GAAAGACAAGGGAGAAGAGTTGG + Intergenic
1006181002 6:32153513-32153535 TATAGGGAGGGGAGTAGAGTAGG + Exonic
1006588923 6:35140649-35140671 GATAGTGAAGAGAGAAAACTTGG + Intronic
1006668340 6:35713873-35713895 CAGAGGGAAGGGAGAAGGGCAGG - Intronic
1007695845 6:43733961-43733983 CAGAGAGAAGGGAGAAGAGTGGG - Intergenic
1009219785 6:60969492-60969514 CATAGTGGGGGAAGAAGAGGAGG - Intergenic
1009525924 6:64746345-64746367 CATGGTGAAGGGCAAAGAGAAGG - Intronic
1010077706 6:71819996-71820018 CCTAATGAAGGGAGAAGGCTGGG + Intergenic
1010325017 6:74554489-74554511 CATAGAGCAGAGAGAAGTGTGGG + Intergenic
1010330258 6:74615393-74615415 CACAGTGAAGGGAGAGAAGTAGG + Intergenic
1010819870 6:80401055-80401077 CCTATTGAAGGGTGAAGGGTGGG + Intergenic
1012053556 6:94374944-94374966 CAAAGTGAAGGGATATTAGTGGG + Intergenic
1012369497 6:98486053-98486075 GATTGTGAAGGGAGATGAGGAGG - Intergenic
1012903003 6:105029566-105029588 GAGAGTGATGGTAGAAGAGTAGG + Intronic
1013176589 6:107683025-107683047 CATCTTGATGGGAGTAGAGTAGG - Intergenic
1014002985 6:116385512-116385534 AATAGGGAAGGGAGAAAAGGAGG + Intronic
1014431377 6:121374577-121374599 CCTAGTGAAGGGAAAACATTAGG + Intergenic
1016527116 6:145014285-145014307 GAGAGTGAGGGGAGAAGAGTTGG + Intergenic
1018049949 6:160000327-160000349 CATGGTGACAGGAGAGGAGTGGG + Intronic
1018132137 6:160741810-160741832 CCTACTTGAGGGAGAAGAGTGGG - Intronic
1019304261 7:325416-325438 CATCGTGGAAGGAGAAGGGTGGG - Intergenic
1019957588 7:4427555-4427577 AATAGTGAAGGGAGGAGTGAGGG - Intergenic
1020405011 7:7823261-7823283 CATAGTTAAGGGAAAAAAGTTGG - Intronic
1020988269 7:15163419-15163441 CATATTGGATGGAGAAGAGTTGG - Intergenic
1021012629 7:15490502-15490524 CACACTTAAGGAAGAAGAGTGGG - Intronic
1021179305 7:17487693-17487715 AATAGGGAAGGGAGAAGAGCAGG - Intergenic
1023333818 7:39147674-39147696 CTTAGAGAAGTGGGAAGAGTTGG + Intronic
1025757610 7:64359527-64359549 CCTATGGAAGGGAGATGAGTAGG + Intergenic
1026504978 7:70974643-70974665 CAGAGTGCAGTGAGAAGAGACGG + Intergenic
1027360527 7:77403849-77403871 GATCGTTAAGGGAGAAGAGAAGG + Intronic
1027852707 7:83469242-83469264 CATAATGAAGGGAAAAGATGCGG - Exonic
1028772809 7:94646353-94646375 AATAGTTAATGGAGAAGAGAAGG + Intronic
1030045249 7:105489451-105489473 CAGAGTGAAGGGGCAGGAGTGGG - Intronic
1030241618 7:107332333-107332355 CAGAGTGGAGAGAGAGGAGTGGG + Intronic
1030400356 7:109041539-109041561 CATAGTGAATGGACAAAAGCTGG + Intergenic
1031212840 7:118852977-118852999 CATATTCAAGGGAAATGAGTTGG - Intergenic
1031509632 7:122633792-122633814 CATACTGGATGGAGAAGAGCTGG - Intronic
1031849750 7:126849790-126849812 CATGGTAAAGGGAGAGGAGATGG - Intronic
1032273641 7:130434813-130434835 TATAGTCAAAGGAGAAGAGTGGG + Intronic
1033416207 7:141163437-141163459 CAAAGAGAAGGGTGAAGAATTGG + Intronic
1034828234 7:154286715-154286737 AAGAGTGAGGGGAGAAGAGCTGG - Intronic
1036682501 8:10885832-10885854 CCTGGGGAAGGGAGAAGAGATGG + Intergenic
1037476935 8:19267188-19267210 CCTATCAAAGGGAGAAGAGTGGG + Intergenic
1039853758 8:41395235-41395257 CATGGTGAAGGGCAAAGAGAGGG + Intergenic
1040765382 8:50903573-50903595 CATAGTAAAGGAAGAGGAGAAGG - Intergenic
1040905857 8:52469414-52469436 CAAAGAGAAGGGAGGACAGTTGG + Intergenic
1041415427 8:57602772-57602794 TACTGTGAAGGGAGAAGAGAGGG + Intergenic
1041858652 8:62485667-62485689 CGGGGTGAAGGGAGAAGTGTTGG + Intronic
1042926014 8:73969481-73969503 CATAGTGAAGGAAGAGTGGTGGG - Intronic
1042952212 8:74212446-74212468 CATAAGGAGGGGAGAAGAATGGG - Intergenic
1043296483 8:78669728-78669750 CAAAGTAAGGGGAGAAGAGATGG - Intronic
1045879983 8:107027235-107027257 AAGAGTGAAAGGAGAAGAGTGGG + Intergenic
1045905816 8:107343332-107343354 GAGAGGGAAGGAAGAAGAGTTGG + Intronic
1046389416 8:113549463-113549485 CATAATGAAGGAAGGAGAGAAGG - Intergenic
1046692282 8:117299188-117299210 CATAGTGAAAGGAGGAGGGAGGG - Intergenic
1046790761 8:118319333-118319355 CAGGGTGAAGGGAGAGAAGTGGG - Intronic
1047486539 8:125336045-125336067 TGTAATAAAGGGAGAAGAGTAGG + Intronic
1047928602 8:129704416-129704438 CAGAGGGAAGGGAGGAGAGAAGG - Intergenic
1048773125 8:137916860-137916882 GAAAGTGGAGGGAGAAGAGATGG - Intergenic
1049593578 8:143473428-143473450 CCTAGTGCAGGGAGAGGCGTGGG - Intronic
1051497330 9:17737977-17737999 CATAGTTGAGAGAGAAGAGTAGG - Intronic
1052982019 9:34457209-34457231 TATAGTGAGGGGGGAAGAGAGGG - Intronic
1053153585 9:35757647-35757669 GACAGTGAAGGGTGAAGGGTAGG + Exonic
1053174590 9:35912786-35912808 GATCTGGAAGGGAGAAGAGTGGG + Intergenic
1053593952 9:39541082-39541104 CATAGAGACGGGAAAATAGTTGG + Intergenic
1053851736 9:42296137-42296159 CATAGAGATGGGAAAATAGTTGG + Intergenic
1054572298 9:66823871-66823893 CATAGAGACGGGAAAATAGTTGG - Intergenic
1055011806 9:71574805-71574827 AATAGTGAAGGGAAAGGATTAGG + Intergenic
1057155877 9:92838841-92838863 CCTACTGGAGGGTGAAGAGTGGG + Intergenic
1057445908 9:95114478-95114500 CATGGTGAAGTGAGAAGTGGAGG - Intronic
1058174353 9:101720841-101720863 CCTACTGGAGGGTGAAGAGTGGG + Intronic
1058827295 9:108786583-108786605 CTTAGGGAAGGGAGAAGGGAGGG + Intergenic
1059054294 9:110962541-110962563 AATCTTGAAGGAAGAAGAGTAGG - Intronic
1059250267 9:112881954-112881976 GATGGAGAAGGGAGAAGAGTGGG + Intronic
1059695041 9:116722789-116722811 CTTAGTGAAGGGAGGAGTGGAGG - Intronic
1059728527 9:117032873-117032895 CATAGGGAACAGAGAAGACTTGG + Intronic
1060707368 9:125816292-125816314 CATTGAGAAGGGGGAAGAGCCGG - Intronic
1061408061 9:130403497-130403519 CATGGTGACAGGAGAAGGGTTGG - Intronic
1061952026 9:133941945-133941967 CAGAGAGAAAGGAGAATAGTGGG + Intronic
1186299307 X:8182370-8182392 TACAATGAAGGGAGAGGAGTAGG - Intergenic
1186313946 X:8348940-8348962 CATAGGGAAGGGTGAGAAGTTGG - Intergenic
1186939166 X:14485918-14485940 CATGGGGCAGGGAGAAGAGCAGG - Intergenic
1187010148 X:15270267-15270289 GAGAGTGAAGGGAGCAGGGTGGG + Intronic
1187483665 X:19681744-19681766 GAAAGTGAAGGGAGAGCAGTGGG + Intronic
1187640960 X:21289179-21289201 CATACTGAATGGACAAAAGTTGG - Intergenic
1187750044 X:22452675-22452697 CATAGAGAATGAAGAAAAGTTGG + Intergenic
1187844872 X:23524801-23524823 AATAGAGGAGAGAGAAGAGTGGG + Intergenic
1188618301 X:32187309-32187331 AAAAATGAAGGGACAAGAGTAGG + Intronic
1188874529 X:35413802-35413824 CATTGTGAATGGAGCAGATTTGG - Intergenic
1191121787 X:56913911-56913933 CATACTGAATGGAGAAAAGCTGG - Intergenic
1191217105 X:57944387-57944409 CATACTGAACGGGGAATAGTTGG - Intergenic
1191599892 X:62991265-62991287 CCTAGTGAAGGGGGAAGAGAAGG - Intergenic
1192226343 X:69230800-69230822 CAGTGTGAAGGCAGTAGAGTGGG - Intergenic
1193176386 X:78400080-78400102 CATGGAGAAGGAAGAAAAGTAGG + Intergenic
1193333588 X:80262356-80262378 CAGAGTGATGGTTGAAGAGTTGG - Intergenic
1193760014 X:85452959-85452981 CATAGGAAAGGAAGGAGAGTTGG + Intergenic
1193776254 X:85646053-85646075 CATACTGAAGGGACAAAAGCTGG + Intergenic
1194087430 X:89546191-89546213 AATAGTGAAGGAAGCAGGGTTGG - Intergenic
1194094048 X:89614624-89614646 CCTACTTAAGGGAGGAGAGTGGG + Intergenic
1194808609 X:98362616-98362638 GATAGTGATGGGAGATGAGAAGG + Intergenic
1195432323 X:104803222-104803244 TATAGTTCAGGCAGAAGAGTTGG - Intronic
1196980643 X:121209643-121209665 AAAAGAGAAGAGAGAAGAGTGGG - Intergenic
1197017932 X:121649848-121649870 CTTAGTGAAGAGAGAATATTTGG - Intergenic
1197041940 X:121947936-121947958 CATAGTGAAAGCAGGAGTGTGGG + Intergenic
1198921349 X:141731863-141731885 CAAAGAGTAGGTAGAAGAGTAGG - Intergenic
1200059168 X:153476647-153476669 CATACTGAAATGAGAAGACTGGG + Intronic
1200440077 Y:3202063-3202085 AATAGTGAAGGAAGCAGGGTTGG - Intergenic
1200446669 Y:3270768-3270790 CCTACTTAAGGGAGGAGAGTGGG + Intergenic
1200974148 Y:9190394-9190416 CATAGAGATGAGAGAAGAGATGG - Intergenic
1202136729 Y:21673235-21673257 CATAGAGACGAGAGAAGAGATGG + Intergenic