ID: 998672126

View in Genome Browser
Species Human (GRCh38)
Location 5:144365812-144365834
Sequence TGGTACACACAGATAGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998672126_998672129 20 Left 998672126 5:144365812-144365834 CCTTAGCCTATCTGTGTGTACCA 0: 1
1: 0
2: 1
3: 3
4: 91
Right 998672129 5:144365855-144365877 TACTATTAAGTAGAAAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998672126 Original CRISPR TGGTACACACAGATAGGCTA AGG (reversed) Intronic
902255376 1:15185786-15185808 TGGTACCCACAGATGGGCATAGG - Intronic
903941817 1:26937188-26937210 TGGCACACCCAGAGAGGGTACGG - Intronic
906260082 1:44380415-44380437 TGATGCACACAGAAAGGCTGAGG - Intergenic
911301111 1:96175562-96175584 TGATAGACACAGATTTGCTAAGG - Intergenic
912960961 1:114195636-114195658 TGGTCCACACTGAGAGGCAAAGG + Intergenic
913149799 1:116029758-116029780 TTGAAAACACAGAGAGGCTAAGG + Intronic
913494563 1:119416584-119416606 TGGGGCACACAGAGAGGCAAAGG - Intronic
917838011 1:178956101-178956123 TGGGACACACAGAGAGACCAGGG + Intergenic
918720438 1:187845778-187845800 TGGTACACTCATGTAGCCTAAGG - Intergenic
923909411 1:238423767-238423789 GGATACACACAGCTAAGCTATGG - Intergenic
924227656 1:241935169-241935191 TGGCACACACAGCTAGGCTGTGG + Intergenic
1064578519 10:16770117-16770139 CGGTACAGACAGATCGGCTTGGG + Intronic
1066615877 10:37294476-37294498 TGTTTCACACAGATATTCTAGGG + Intronic
1073460915 10:103665464-103665486 TGGAAAGCACAGACAGGCTATGG + Intronic
1074472247 10:113738015-113738037 TGGTCTACAGAGTTAGGCTAGGG - Intergenic
1078075578 11:8157047-8157069 TGGTACTCACAGATAAGTTGTGG + Intronic
1079351372 11:19694724-19694746 TGGTTCATGCAGATAGACTAGGG + Intronic
1082610255 11:55287354-55287376 TGGGACACACAGAGTGGCTTTGG - Intergenic
1082656336 11:55862339-55862361 TGGGACACACAGAGTGGCTTTGG + Intergenic
1083079793 11:60078896-60078918 TGGTAGAAACAGATATGCTATGG + Intergenic
1084782108 11:71416908-71416930 TGGAAAACACAGAGAAGCTAAGG + Intergenic
1085456821 11:76670314-76670336 AGGAACACACAGCTAGGCAAGGG - Intronic
1092508403 12:9127643-9127665 TGGAGGACACAGACAGGCTACGG - Intergenic
1099734196 12:86546867-86546889 TGGTAAAAACAGAAATGCTAGGG + Intronic
1100124856 12:91411755-91411777 TGGTAGACACAGTGAGGCAAGGG - Intergenic
1103298400 12:119907656-119907678 TGGTACACACCTGTAGTCTAAGG + Intergenic
1119793414 14:77374883-77374905 TGGTACTCGCAGACAGGTTATGG - Intronic
1120292961 14:82600790-82600812 TGTTATACACAATTAGGCTATGG - Intergenic
1120979723 14:90279166-90279188 TAGTTGACACAGAGAGGCTAAGG + Intronic
1125681884 15:41536118-41536140 CGGGACACACAGGTAGGCAAGGG - Exonic
1136140938 16:28288286-28288308 TGGTTCACACAGGAAGGCTCTGG - Intergenic
1141966444 16:87447964-87447986 TTGTACACACAGATTGTCCAGGG - Intronic
1143001118 17:3795609-3795631 TGGTAAACAGAGAGAGGCCAGGG + Intronic
1146753684 17:35407285-35407307 TGGTACACGGAGCCAGGCTAAGG - Intergenic
1151527602 17:74681584-74681606 TGGCACACAAAGAGAGGCTTGGG + Intronic
1153198886 18:2629619-2629641 TGGTAGGCAAAGATATGCTAGGG + Intergenic
1165472568 19:36011652-36011674 TGGTAGACACAGGTGGGCTTTGG - Intronic
1166126649 19:40718763-40718785 ATGTACATACAAATAGGCTAAGG - Intronic
1168520962 19:57050214-57050236 TGCTACCCCCAGATAGGCTCTGG - Intergenic
926399320 2:12480306-12480328 TAATACAGACAAATAGGCTAGGG - Intergenic
926955514 2:18291085-18291107 TGGTGCACCCAGAGAGGGTATGG - Intronic
927627489 2:24737296-24737318 TTGCACACACAGATAGTCAAGGG + Intronic
932772532 2:74508380-74508402 TGCCACACACAGACAGGCTTAGG + Exonic
934589872 2:95538108-95538130 TGGGACACACAGAGTGGCTTCGG - Intergenic
934593934 2:95586549-95586571 TGGGACACACAGAGTGGCTTTGG + Intergenic
934788846 2:97039135-97039157 TGGGACACACAGAGTGGCTTTGG - Intergenic
937673527 2:124564256-124564278 GGGGAGACAGAGATAGGCTAGGG + Intronic
941647447 2:168056545-168056567 TGTCACACCCAGATAGGCTCGGG + Intronic
944270644 2:197782240-197782262 TGGCACTCACAGCTAGGCTGTGG + Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1178323943 21:31628211-31628233 TGGTACACACTGATCCCCTATGG - Intergenic
1181510371 22:23386242-23386264 TGGGACACACAGACAGGCCCTGG + Intergenic
1181964760 22:26648475-26648497 TGGTGCACACAGCAAGGCTCAGG - Intergenic
1182365878 22:29778928-29778950 TGGTTCACACAAATAAGCAAAGG - Intergenic
954900972 3:54019439-54019461 TGGAAAACAAAGAAAGGCTAAGG - Intergenic
954974416 3:54679442-54679464 TGATGCACACAGAGAGGATATGG - Intronic
957959891 3:87236046-87236068 TGGCACACACAGAGAGGGCATGG - Intronic
958981643 3:100727166-100727188 TGGCACTCACAGGTAGGCTGTGG - Intronic
958992105 3:100858691-100858713 TAGTACCCACAGGTAGGCTGTGG + Intronic
960576122 3:119231347-119231369 TTGTCCACACAGAGAGGATATGG - Intronic
967846175 3:194044970-194044992 TGGAGCACACTGAGAGGCTAAGG - Intergenic
974182970 4:58406916-58406938 TGGTACAAACACATAGCCCAGGG - Intergenic
974804953 4:66866865-66866887 AGTTACACACAGATAGAGTACGG - Intergenic
979538205 4:121849142-121849164 TGGTACCCACAAATATACTAGGG - Intronic
983085883 4:163443527-163443549 TGATACTCACAGCAAGGCTATGG - Intergenic
983374878 4:166913399-166913421 TTGTTCACACAAATAGGCAAAGG - Intronic
983670906 4:170236888-170236910 TGGTACATACAGATCAGGTAAGG + Intergenic
995046103 5:107650176-107650198 AGGTACAAACAGCTATGCTAAGG + Intronic
998672126 5:144365812-144365834 TGGTACACACAGATAGGCTAAGG - Intronic
999786819 5:154898211-154898233 TTGTACAAACAGATAAGCAATGG + Intronic
1000249999 5:159485199-159485221 TGGTACAGACAGATAAACCATGG - Intergenic
1003566435 6:7226700-7226722 TGGTCCACACAGTTAGACCATGG + Intronic
1006691949 6:35895930-35895952 TGGTACACCCAGAGAGGGCATGG + Intronic
1008221438 6:48858758-48858780 TGCTACAGAAAAATAGGCTAAGG - Intergenic
1012535013 6:100284702-100284724 TGGTGCATGCAGAGAGGCTAAGG - Intergenic
1012565038 6:100638312-100638334 TATTACACACTAATAGGCTATGG + Intronic
1016876412 6:148870166-148870188 TGGTATACACAGCAAGGCAATGG - Intronic
1017984093 6:159427283-159427305 TGCCTCACACAGAGAGGCTAAGG - Intergenic
1018211533 6:161487352-161487374 TGGCTCACACAGATGGGCGAAGG - Intronic
1019818557 7:3220337-3220359 TGTTGCACCCAGATAAGCTACGG + Intergenic
1026143475 7:67725737-67725759 AGGCACACACACATATGCTAAGG - Intergenic
1033024558 7:137760016-137760038 TGAGACACACAGATAGACTGAGG + Intronic
1041213836 8:55580196-55580218 TGGTAGACACAGATATGCTATGG + Intergenic
1045331899 8:101162370-101162392 TGGTACACCCAGAGAGGGCATGG + Intergenic
1045843361 8:106605281-106605303 TAAAACACACAGATAGGGTATGG + Intronic
1048819553 8:138368261-138368283 TGGTACTGACAGATAGGAAAGGG - Intronic
1049317969 8:141979712-141979734 AGCTACACACAGAGAGGCTGAGG + Intergenic
1052939602 9:34122086-34122108 TGATACTGACAGATAAGCTAAGG - Intronic
1058726924 9:107813327-107813349 TGGTACACTCAGAGAGGGCATGG - Intergenic
1059479233 9:114575548-114575570 GGGCACACACACATAGGCTCTGG + Intergenic
1185837062 X:3354614-3354636 TGGTACACACACAAAGGAGAAGG - Intergenic
1189091156 X:38084241-38084263 TGGTACACACAGGGAGGGCATGG + Intronic
1190260445 X:48793732-48793754 TGGTTGACACAGAGAGGCAAAGG + Intronic
1192848376 X:74928196-74928218 TGGCACTCACAGGTAGGCCATGG - Intergenic
1195579215 X:106482522-106482544 TGGTAATAACAGGTAGGCTAGGG - Intergenic
1201239507 Y:11945136-11945158 TGGTACACACAGAAAGGAGAAGG + Intergenic