ID: 998672659

View in Genome Browser
Species Human (GRCh38)
Location 5:144371174-144371196
Sequence TTGTTGAAGCAGAGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 1, 2: 1, 3: 34, 4: 336}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998672659 Original CRISPR TTGTTGAAGCAGAGTGAGGC AGG (reversed) Intronic
900800902 1:4736417-4736439 TTTTTGGAGCAGAGTGAGCTGGG - Intronic
901270738 1:7951482-7951504 TTTTTGAAGCACATTGTGGCAGG + Intergenic
901633649 1:10659771-10659793 GTGTTGAAGGACAGGGAGGCAGG + Exonic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902983008 1:20139054-20139076 TTGTTGAAACACAGTAAGGCAGG - Intergenic
903290599 1:22311697-22311719 TGGTCGGAGCAGAGTGAGGGAGG + Intergenic
903541270 1:24097692-24097714 TGGTGGAAGGTGAGTGAGGCAGG - Intronic
903992246 1:27281422-27281444 TTTTTGAGACAGAGTCAGGCTGG - Intronic
904413375 1:30339194-30339216 TTTCTGAAGCAAAGTGAGGTGGG + Intergenic
905106528 1:35566342-35566364 GTGTTGCAGCAGAGTGACGATGG + Exonic
905672837 1:39803581-39803603 TTCTTGAAACAGAGTCAGGCTGG - Intergenic
906283253 1:44568277-44568299 TGGCTGGAGCAGAGTGAGGTGGG - Intronic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907915882 1:58869752-58869774 TTTTTGAAGCAGTGTGACTCTGG - Intergenic
909714475 1:78691368-78691390 TTGTAGAAGCTGAGTGATGAAGG + Intergenic
909916313 1:81324016-81324038 GAATTTAAGCAGAGTGAGGCAGG + Intronic
910851969 1:91657346-91657368 TTCTTGAAGGTGAGAGAGGCTGG - Intergenic
912232234 1:107807634-107807656 TGTATGAAGCAGAGTGGGGCTGG - Intronic
912940368 1:114039482-114039504 TTTTTGAAGGAGTGTAAGGCTGG + Intergenic
914499840 1:148236219-148236241 TTGTTGAAGCAGCGAGACGGAGG - Intergenic
916458050 1:164991495-164991517 TTGTTGGAGAAGAGTGATTCTGG + Intergenic
916810220 1:168298946-168298968 TTTTTGAGACAGAGTCAGGCTGG + Intronic
917186603 1:172363608-172363630 TTATTTAAGGAGAGTGAGACTGG - Intronic
919677384 1:200397106-200397128 TTGTTGAAGCAGAATGACTGTGG - Intergenic
920868161 1:209770219-209770241 ATATTAAAGCAGAGTGAGGGCGG - Intronic
920955546 1:210617383-210617405 TTGATGAAGTAGAGAGAGGAAGG + Intronic
921020971 1:211235350-211235372 CTGTTGAAGGATAGTGGGGCAGG - Intergenic
921605774 1:217152678-217152700 GTGTGGAGGCAGAGTCAGGCTGG + Intergenic
923079846 1:230642640-230642662 TTGTCGAAGCAGAGCGTGTCCGG - Exonic
924878723 1:248134728-248134750 ATGTTGAAGCATAGTAAGGAAGG + Intergenic
1065299666 10:24309849-24309871 TTGTGGTAGCAGAGTGTTGCAGG - Intronic
1065385117 10:25126383-25126405 TTGTAAAAGCAGATTGAGGCTGG - Intergenic
1065951851 10:30659466-30659488 TTATTGAAGCAGAGGAAGGGGGG + Intergenic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1067761900 10:49054706-49054728 TTTTGAAAGCAGAGTGTGGCTGG - Intronic
1070193472 10:74133682-74133704 TTGTTGAGACAGAGCCAGGCTGG + Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070920741 10:80184078-80184100 TTGTTGAAGCTGAGGGATGATGG - Intronic
1071587021 10:86833497-86833519 TAGATGAAGCAGAGGGAGGTGGG + Intronic
1072329932 10:94337460-94337482 TTGTTGAACCTGAGTGATGGGGG + Intronic
1072535698 10:96360931-96360953 TTGATTGATCAGAGTGAGGCAGG + Intergenic
1072634052 10:97165891-97165913 TTGGTGAGGCTGAGCGAGGCTGG - Intronic
1073255619 10:102149154-102149176 TAGTAGGAGGAGAGTGAGGCAGG - Intronic
1073267199 10:102234872-102234894 TTATTTCAGCAGAGGGAGGCAGG + Intronic
1075076123 10:119351617-119351639 TTTATCAAGCAGAGTGAGGATGG + Intronic
1076316517 10:129545628-129545650 TTGCAAAAGCAGAGGGAGGCTGG - Intronic
1078043737 11:7893703-7893725 TTGTTGGAGCAGAGAGTGGATGG + Intergenic
1079197935 11:18346845-18346867 TTGGGGAGGCTGAGTGAGGCAGG - Intronic
1079541418 11:21580430-21580452 GTTGTGAATCAGAGTGAGGCTGG - Intergenic
1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG + Intergenic
1081085993 11:38802092-38802114 ATGTTGAAGCAGAGTGAGTTTGG + Intergenic
1083318806 11:61832684-61832706 TTTCTGCAGCAGAGAGAGGCAGG - Intronic
1083474011 11:62904032-62904054 CAGTTAAAGCAGAGAGAGGCCGG - Intergenic
1084349017 11:68580593-68580615 TAGTTGAAGAAGAGTGAAGGTGG + Intronic
1085371476 11:76010747-76010769 TTGTTGCAAAAGAGAGAGGCAGG + Intronic
1086897221 11:92327299-92327321 TAGTTCAAGCAGAATGAAGCAGG + Intergenic
1086946535 11:92849472-92849494 TTGTAGAAGCAGGGTTAGCCAGG - Intronic
1086980743 11:93195699-93195721 TGGCTGAAGCAGAGTGATGGAGG - Intronic
1087161046 11:94948416-94948438 GTTTTGAAGCAGAGGGAGGGAGG - Intergenic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1090394895 11:126412414-126412436 TTGCTGAAGCGGAGGAAGGCGGG + Intronic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1091684833 12:2554368-2554390 TTCTTGAAGAAGAGCGAGGAGGG - Intronic
1095851961 12:46819694-46819716 TTGTTGAAACCAAGTGAAGCTGG + Intronic
1096007045 12:48182172-48182194 TTGGTGATGAAGAGTGAGGCTGG - Intergenic
1096684317 12:53277709-53277731 TTGTGGAAGCAGTGGGAGGTTGG + Intronic
1097225513 12:57474974-57474996 CTGGGGAAGTAGAGTGAGGCGGG + Intronic
1097320663 12:58222522-58222544 AGGTTGAAGCAGAGAGAGTCTGG - Intergenic
1098836088 12:75425707-75425729 GTGTCTAAGCAGAGTGAGGAGGG + Intronic
1098946723 12:76598183-76598205 TTGTTGAAGCTGAGAATGGCTGG + Intergenic
1099497171 12:83363469-83363491 ATGTTCAAGCAATGTGAGGCAGG - Intergenic
1099541034 12:83907907-83907929 TGGCTGGAGCAGAGTGAGGTGGG + Intergenic
1099657151 12:85508289-85508311 TTGTTGAAGTGGAGTGAACCAGG + Intergenic
1099853437 12:88134259-88134281 TTGTTGGAGGAGAGGGAGGATGG - Intronic
1100370521 12:93965063-93965085 TTGATGAAGTAGAGCGTGGCTGG - Intergenic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101943333 12:109117066-109117088 TTTTTAAAGCAGACTAAGGCTGG + Intronic
1103033117 12:117633956-117633978 TATGTGAAGCAGAGTCAGGCAGG - Intronic
1103147744 12:118610245-118610267 CAGGTGATGCAGAGTGAGGCAGG - Intergenic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1103739122 12:123079376-123079398 TTTTTGAGACAGAGTCAGGCTGG + Intronic
1104642045 12:130473572-130473594 TAGATGGAGCAGAGTGAGGGAGG + Intronic
1104690685 12:130823716-130823738 TTGTTGAAGCACAGTGATTGCGG + Intronic
1105578822 13:21675233-21675255 GTGGGGAAGCAGGGTGAGGCAGG + Intronic
1106389830 13:29324246-29324268 TTGTTATGGCAGAGAGAGGCAGG + Intronic
1107355562 13:39561828-39561850 TTGTTGAATCAGAGTGAATATGG + Intronic
1107446423 13:40473823-40473845 TTGTTAAAGCATGGTAAGGCAGG + Intergenic
1107517491 13:41145178-41145200 TTTTTGAGACAGAGTCAGGCTGG - Intergenic
1108288981 13:48938678-48938700 TTGATCAAGGAGAGTGAGCCTGG - Intergenic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1109654062 13:65366590-65366612 GTGATGAGGCAGAGTGACGCTGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1111845922 13:93508404-93508426 ATGTTTAAGCAAGGTGAGGCTGG + Intronic
1111942773 13:94630630-94630652 TTGATGAAGGACAATGAGGCTGG - Exonic
1112036387 13:95500478-95500500 GTGTTGGAGTAGAGTGAGGGTGG + Intronic
1112131398 13:96527762-96527784 TGGCTGGAGCAGAGGGAGGCAGG + Intronic
1112240566 13:97677450-97677472 TTGTTGAAACACAGATAGGCTGG - Intergenic
1112725823 13:102303070-102303092 TGGGTGGAGCAGAGTGAGTCGGG - Intronic
1113037510 13:106067186-106067208 TTATTGATGCAGAGTGAGTGGGG + Intergenic
1113545257 13:111143830-111143852 TTGTTGAATGAGAGTGAGCTGGG - Intronic
1115369957 14:32602247-32602269 TTGTTGTAGGAGGCTGAGGCAGG + Intronic
1116253109 14:42513515-42513537 TTTTTTAAGCAGGGTGAGCCAGG - Intergenic
1116986734 14:51227854-51227876 TGGATGGAGCAGAGTGAGGAAGG + Intergenic
1117502161 14:56363834-56363856 TTTTTGAAGCTTAGTGTGGCTGG + Intergenic
1118072234 14:62257702-62257724 ATGATGCAGCAGAGGGAGGCAGG + Intergenic
1118225824 14:63898255-63898277 GTGATGCAGCAGATTGAGGCAGG - Intronic
1118675300 14:68178092-68178114 TTGTTGAAGCAGCCTCAGGCAGG - Intronic
1118742837 14:68753028-68753050 ACCCTGAAGCAGAGTGAGGCTGG - Intergenic
1119939924 14:78629418-78629440 TGGTTGAAGCAGAGTTAGGAGGG + Intronic
1120005999 14:79358542-79358564 TTTTTGAGACAGAGTCAGGCTGG - Intronic
1120327269 14:83046972-83046994 TTTTGGAAGAAGAGAGAGGCTGG + Intergenic
1120571564 14:86124163-86124185 TTGTAGAAGCTGAGTGAGAAAGG + Intergenic
1121351566 14:93177477-93177499 CTCTAAAAGCAGAGTGAGGCTGG + Intergenic
1121960917 14:98258643-98258665 TGGTTGAAGCAGAATGAGAAAGG - Intergenic
1124996192 15:34725112-34725134 CTGTTGATCCAGAGTGAGTCTGG - Intergenic
1126374812 15:47986810-47986832 GTGGTGAAACAAAGTGAGGCAGG + Intergenic
1127674773 15:61228830-61228852 TTGCGGGAGCAGAGTGGGGCGGG - Intronic
1127736546 15:61845504-61845526 TTGTTGAAGCTAATTGTGGCAGG + Intergenic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1128072169 15:64804559-64804581 TGGATGAAGGAGAGTGAGGTGGG + Intergenic
1128107469 15:65055278-65055300 GTGAGGAAGCAGTGTGAGGCAGG + Intronic
1129477274 15:75794603-75794625 CTGTTGCAGCAGAGTGAGGGTGG - Intergenic
1130435382 15:83893177-83893199 ATGTTGAAGCAGAGTCAATCAGG + Intronic
1130758017 15:86786369-86786391 TTGTAGAAAGAGAGTGTGGCAGG + Intronic
1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG + Intronic
1133455851 16:5941872-5941894 TTTCTGAAGCAGACTCAGGCCGG - Intergenic
1135535863 16:23294046-23294068 GTCTTGAATCAGAGTGAGGTGGG - Intronic
1138653276 16:58473975-58473997 TGGCTGGAGCAGAGTGAGCCAGG - Intronic
1140318734 16:73927097-73927119 TTGTTGAAGCATTTTGAGGATGG + Intergenic
1140323162 16:73973650-73973672 GTGTTGAAGCTGAGTGACGGTGG - Intergenic
1141801123 16:86309957-86309979 TTGAGGAAGCAGACAGAGGCTGG + Intergenic
1141919861 16:87128448-87128470 TTGGTGAAGCAGGGTGTGGAAGG - Intronic
1142287788 16:89178469-89178491 TGGGAGAAGAAGAGTGAGGCTGG + Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143767410 17:9146657-9146679 GTGCTGAGACAGAGTGAGGCGGG + Intronic
1145822552 17:27850722-27850744 CTGTGGAAGGAGAGTGATGCTGG + Intronic
1146933456 17:36794498-36794520 TTGGTGAAGAAAACTGAGGCCGG + Intergenic
1147241639 17:39094500-39094522 TTGTAGACTCAGAGTGGGGCCGG - Intronic
1147659165 17:42107981-42108003 GTGGTGAAGCTGAGTGAGGCTGG - Exonic
1148572302 17:48679861-48679883 TTATTGAAGCGGAGTGAGGGTGG - Intergenic
1149611588 17:57961210-57961232 TTCTTAAAGAATAGTGAGGCCGG + Intergenic
1149671515 17:58416964-58416986 TTGCTGAGGCAGAGGGAGGGGGG + Exonic
1150612472 17:66744965-66744987 TTGTAGGAGAAGAGGGAGGCTGG - Intronic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1151446831 17:74171873-74171895 TTGTAGAAGTAAAGTGGGGCTGG + Intergenic
1151985957 17:77543918-77543940 TTGTTGAAACAGAGTCAGGGTGG + Intergenic
1153252390 18:3135720-3135742 TTCTTGCTGCAGTGTGAGGCAGG - Exonic
1153324624 18:3805419-3805441 GAGTTGGAGCAGAGAGAGGCTGG + Intronic
1153478052 18:5518241-5518263 TGGTTGGAGCAGAGAGAGGGAGG - Intronic
1153862694 18:9229953-9229975 TTGTGGAATCAGGGTGATGCTGG + Intronic
1155494410 18:26428714-26428736 TAGTTAAAGCAGACTGAGGCAGG - Intergenic
1155663034 18:28274762-28274784 TTTTTAAAGCAGAGTGGGGAAGG - Intergenic
1155720744 18:29008726-29008748 ATGTTATACCAGAGTGAGGCTGG + Intergenic
1157480837 18:48052601-48052623 TAGTTGGAGCAGAGAAAGGCCGG + Intronic
1157904010 18:51550171-51550193 ATGTTGAAGAAAAGTGAGGGTGG + Intergenic
1160182823 18:76650495-76650517 TTGTTGAAGCAGTTTGACGATGG + Intergenic
1161120589 19:2523659-2523681 CTGTGGAACCTGAGTGAGGCTGG + Intronic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161289397 19:3484998-3485020 TGGCTGGAGCAGAGTGAGCCGGG + Intergenic
1161422021 19:4181171-4181193 TGGCTGGAGCAGAGTGAGGCAGG - Intronic
1161596647 19:5154164-5154186 TGGCTGGAGCAGAGGGAGGCAGG + Intergenic
1161599168 19:5170422-5170444 TGGCTGCAGCAGAGTGAGCCAGG + Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161657953 19:5527296-5527318 ATATTAAAGTAGAGTGAGGCTGG + Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161765033 19:6202799-6202821 TGGCTGGAGCAGAGTGAGGGAGG + Intergenic
1161815691 19:6498543-6498565 CGGCTGAAGCAGAGTGAGGGAGG - Intronic
1162110352 19:8396690-8396712 TGGCTGGAGCAGAGTGAGCCGGG + Intronic
1163018076 19:14468938-14468960 TTTTTGAGACAGAGTCAGGCTGG - Intronic
1163579206 19:18128342-18128364 TGGGTGATGCAGGGTGAGGCAGG + Intronic
1164473837 19:28557298-28557320 TTGTTGAAGCAGTGAGATGGTGG + Intergenic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1166891550 19:45997066-45997088 TGGCTGCAGCAGAGTGAGCCAGG - Intronic
1167842682 19:52134903-52134925 TTGTTGCAGCAGACAGAGGTGGG + Intronic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
926161073 2:10489834-10489856 TGATTGATGCAAAGTGAGGCTGG - Intergenic
926690896 2:15732666-15732688 GTGTTGAATCATAGTGAGACTGG + Intronic
926800095 2:16652620-16652642 TTGCTGACGCAGAGGGTGGCAGG - Intronic
928119438 2:28572971-28572993 TTGTTGAAGAAATGTGAGTCTGG - Intronic
928673661 2:33628524-33628546 TTGTTGTAGCAGAGGGAGAATGG - Intergenic
930542555 2:52725027-52725049 GTGTTGAAGCAGAGAGAAGGAGG - Intergenic
932879466 2:75487557-75487579 TTGTTGAAGTAAAGTGAGTCAGG - Intronic
933483139 2:82882490-82882512 TTTTGGAAACAGAGTGAAGCTGG - Intergenic
937267307 2:120624691-120624713 GTGTTGAAGCACAGTGACGCTGG + Intergenic
938242029 2:129749924-129749946 TTTATGAAGCTTAGTGAGGCAGG - Intergenic
939609838 2:144297187-144297209 TTGTTGAAGCTGGGTGATGGTGG - Intronic
940992394 2:160110887-160110909 TTGTTGAGGAAGAGGGAGCCTGG + Intronic
944485355 2:200199756-200199778 GTGTGGCAGCAGGGTGAGGCCGG + Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
947372678 2:229464720-229464742 TTATTGAAGCAGGGTGCGGTGGG + Intronic
947702846 2:232249592-232249614 TTGAGTAAGCAGAGTGATGCCGG + Intronic
948768289 2:240234350-240234372 TGGTTGGGGCAGAGTGTGGCAGG + Intergenic
1168857705 20:1020353-1020375 TGGATGAAGCAGAATGAGGGAGG + Intergenic
1169084392 20:2817603-2817625 TTGGGGATGCAGACTGAGGCAGG - Intronic
1169548545 20:6676628-6676650 TGGTTGAAGCAATGTGATGCAGG + Intergenic
1169756709 20:9050643-9050665 ATGATGAAGCTGAGTGAGGTAGG - Intergenic
1169900337 20:10546363-10546385 TCGTAGAAGCAGTGTGTGGCCGG + Intronic
1170207550 20:13814869-13814891 TTGCAGAAGCAGTGTGAGGGTGG - Intronic
1170792778 20:19521504-19521526 TTCTTGAAGGAGCATGAGGCTGG + Intronic
1170942877 20:20863581-20863603 CTGTGGAAGCAGAGAGAGGGCGG + Intergenic
1170964109 20:21051148-21051170 TGAATGAAGCAGATTGAGGCTGG + Intergenic
1171145130 20:22774782-22774804 TTCATGGAGCAGAGGGAGGCCGG + Intergenic
1172123609 20:32612544-32612566 TTGTTAAGGCAGCCTGAGGCGGG - Intergenic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1174405108 20:50297709-50297731 TGGTTGCAGCAGAGAGAGGAAGG - Intergenic
1174577604 20:51547683-51547705 GAGTTGAGGCACAGTGAGGCAGG - Intronic
1174860123 20:54083503-54083525 TTGTTCAATCAGTGAGAGGCTGG - Intergenic
1175918790 20:62440285-62440307 TCGCTGGAGCAGACTGAGGCTGG + Intergenic
1177014690 21:15771543-15771565 TTGTTGAAGCTGAATGAGCGAGG + Intronic
1178201502 21:30411914-30411936 GTGTTGTATCAGAGTGATGCTGG - Intronic
1178792236 21:35711299-35711321 CAGTTGAGGCAGAGTGATGCTGG + Intronic
1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG + Intergenic
1179639564 21:42738432-42738454 TTGCTGGAGCACAGTGAGGCTGG + Intronic
1180036905 21:45254767-45254789 TTGTGAAAGCAGAGGGAGCCTGG + Intergenic
1180089872 21:45528450-45528472 TTCCTTAACCAGAGTGAGGCCGG - Intronic
1184327186 22:43797825-43797847 TGGTTGAGGCAGAGGGAGCCGGG - Intronic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
950399687 3:12760400-12760422 TTACTGGAGCAGAGTGAGGGAGG - Intronic
950908918 3:16567052-16567074 TGGTTGAAGTAGAGTGAGGGAGG - Intergenic
953067650 3:39489054-39489076 TGGCTGAAGCACAGTGAGGGAGG - Intronic
953530689 3:43737204-43737226 CTGTGGAAGCAGGGTGTGGCTGG + Intergenic
954893837 3:53958336-53958358 CTGTTGAAGAAGACTGAGGAGGG - Intergenic
955905837 3:63806785-63806807 ATACTGAAGCAGAGTCAGGCAGG - Intergenic
958719394 3:97825272-97825294 TTCTTGAAGCAGATAAAGGCAGG - Intronic
959166597 3:102787518-102787540 TTCCTGAAGAAGAGTGAAGCAGG - Intergenic
959592188 3:108092488-108092510 GTGTTGATGCGGCGTGAGGCAGG + Intergenic
961751210 3:129095874-129095896 TTTTAGAAGCAGAGTCTGGCAGG + Intronic
961893962 3:130152139-130152161 ATGTTGAAGGATAGTGAGGGAGG + Intergenic
962020189 3:131491971-131491993 TTTCTGAAGCAGGGTGAGTCAGG - Intronic
962364189 3:134766647-134766669 TGGTGTAAGGAGAGTGAGGCCGG + Intronic
962698686 3:137975824-137975846 TGGCTGCAGCAGAGTGAGGTGGG - Intergenic
963624591 3:147655047-147655069 TTATTGAGGCAGAGTTAGGTAGG + Intergenic
965537320 3:169836836-169836858 TGGCTGGAGCAGAGTGAGCCAGG + Intronic
966238367 3:177727954-177727976 TTGTTAAAGCACAGTGAGAAAGG + Intergenic
966567199 3:181396576-181396598 TGGCTGCAGTAGAGTGAGGCTGG + Intergenic
968289498 3:197527632-197527654 TGGCTGAAGCAGAATGAGGGGGG - Intronic
968471355 4:783936-783958 TTGTTACAGCTGAGTGAGGAAGG - Intergenic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
968764277 4:2459917-2459939 GTGTTGAAGCAGAGGGAAGGTGG + Intronic
968955943 4:3719486-3719508 CTGTTGAAGCACATTTAGGCTGG - Intergenic
969999035 4:11345297-11345319 TCCTCTAAGCAGAGTGAGGCAGG - Intergenic
970067280 4:12112909-12112931 TTTTGGAATCAGGGTGAGGCCGG + Intergenic
970145892 4:13035394-13035416 TTCTTGAAGCAAAAAGAGGCAGG + Intergenic
971067284 4:23047747-23047769 CTGTTGGAGGAGGGTGAGGCAGG - Intergenic
971375879 4:26055570-26055592 TTGTTTAAGCCAATTGAGGCAGG + Intergenic
972202729 4:36734661-36734683 TAGTTGAAACAGAGTGCGGAGGG - Intergenic
972425269 4:38927023-38927045 TGGCTGCAGCAGAGTGAGGCAGG - Intronic
973783895 4:54317462-54317484 TTTTTAAAGCAAATTGAGGCCGG + Intergenic
976718765 4:88150416-88150438 AGGCTGAAGCAGAGTGAGGGAGG + Intronic
977890171 4:102300653-102300675 TTGTTGAAGCAGTGACAGCCGGG + Intronic
978163435 4:105577402-105577424 TTTTTGTATCAGAGTGATGCTGG + Intronic
978525750 4:109663474-109663496 TTGTGGAAGGGGAGAGAGGCAGG - Intronic
979152617 4:117339575-117339597 TTTTTGTATCAGAGTGATGCAGG + Intergenic
981195382 4:141913890-141913912 TTACTGAAGTAGAGTGAGACTGG + Intergenic
981518598 4:145636646-145636668 ATGTTGAAGAAGGTTGAGGCAGG - Intronic
981798591 4:148629234-148629256 TTGTTGTAGAAGACTGAGGTTGG - Intergenic
982048593 4:151475622-151475644 TGGCTGAAGTAGAGTGAGGGAGG + Intronic
982097620 4:151937040-151937062 ATGATGAAGCAGAGAGATGCAGG - Intergenic
982413496 4:155105837-155105859 TGGATGAAGCAGAGTGAAGCGGG + Intergenic
983457949 4:167987281-167987303 TTGTGGAAGCAGAATGATTCAGG + Intergenic
984709996 4:182876798-182876820 TTGTAGATTCAGAGTGAGGTGGG + Intergenic
985718261 5:1475120-1475142 AGGATGAAGCAGAGTGAGGCGGG + Intronic
986811979 5:11369711-11369733 GTGTTGAAGAAAAATGAGGCAGG + Intronic
988960546 5:36366802-36366824 TGGTTGAAGCTGGGTGAGGAAGG - Intergenic
989242584 5:39217896-39217918 TTTTTAAAGCACATTGAGGCTGG + Intronic
990356389 5:54970805-54970827 TTTTTGAGTCAGAGGGAGGCAGG - Intergenic
991392397 5:66160496-66160518 TGGTTGAAGCATAGTGAGTGAGG + Intronic
991961765 5:72051896-72051918 TTAGTGAGGAAGAGTGAGGCTGG - Intergenic
994285626 5:97962196-97962218 AAGCTGAAGCAGAGTAAGGCAGG - Intergenic
996485323 5:124026884-124026906 TGATTGAAGCAGAGTGAGCAAGG + Intergenic
997483480 5:134207663-134207685 TTGTTCATGGAGACTGAGGCAGG - Intronic
997774509 5:136588869-136588891 CTGTTGGAACAGAGTGGGGCAGG + Intergenic
997954307 5:138266701-138266723 TTTTTGAGTCAGAGTCAGGCTGG + Intronic
998469685 5:142374100-142374122 TTATTGAGGCAGAGTCAGGCTGG + Intergenic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
999442829 5:151615617-151615639 GTGCTGAAGCAGAATGAGTCAGG + Intergenic
999857721 5:155613445-155613467 TGGATGGAGCAGAGTGAGCCAGG + Intergenic
1000507037 5:162133899-162133921 TTGTTGAGGCAGAGGCAGGCTGG + Intronic
1001956054 5:175848908-175848930 TGGCTGAAGCAGAGTGAGCCGGG + Intronic
1002168782 5:177363809-177363831 TTGTGGAGGCAGTGGGAGGCAGG - Intronic
1003117627 6:3293803-3293825 TTGTTAAGGCAGAGTGAGGCAGG + Intronic
1003169336 6:3708808-3708830 TTGTTCATGCAGTGTGAGGAAGG + Intergenic
1004281432 6:14282682-14282704 TTCTTGGAGAAGACTGAGGCTGG - Intergenic
1005915888 6:30351214-30351236 GTTTCAAAGCAGAGTGAGGCAGG - Intergenic
1006459319 6:34149206-34149228 TTGTTGAAATAAAGTGAGCCTGG + Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007753101 6:44081842-44081864 ATGATGAGTCAGAGTGAGGCTGG - Intergenic
1008609750 6:53174798-53174820 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1010452296 6:76016563-76016585 ATGCTGATGCAGAGAGAGGCTGG + Intronic
1012415142 6:99005013-99005035 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1015103087 6:129504325-129504347 TTGTTGAACCACAATGAGGCTGG + Intronic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015555755 6:134459752-134459774 TTCTTTAATCAGAGTGAGGAGGG - Intergenic
1016388771 6:143554325-143554347 TTGTTCAAGCACGGTAAGGCAGG + Intronic
1016393986 6:143603254-143603276 TTGTTCAAGCACGGTAAGGCAGG + Intronic
1016948556 6:149557746-149557768 TTTTTGAGACAGAGTCAGGCTGG + Intergenic
1018248172 6:161841996-161842018 TTGTTAAAGAACAGTAAGGCAGG - Intronic
1019512024 7:1422370-1422392 GGGTTGGGGCAGAGTGAGGCTGG - Intergenic
1020713529 7:11639010-11639032 TTGTTCAAGCACAGTGGGGATGG - Intronic
1020984765 7:15119612-15119634 TTCTTGCAGCTGAGTGTGGCTGG + Intergenic
1022891676 7:34707466-34707488 CTGTGGAAACTGAGTGAGGCAGG - Intronic
1023537811 7:41231928-41231950 GTGTGGGAGCAGAGTGAGGCCGG - Intergenic
1023817688 7:43962898-43962920 TTTTTGAGACAGAGTCAGGCTGG - Intergenic
1027602941 7:80261918-80261940 TGGTTGCAGCATAGTGAGGAAGG - Intergenic
1027814092 7:82946657-82946679 TGGTCGGAGCAGAGTGAGGAGGG + Intronic
1029742311 7:102497772-102497794 TTTTTGAGACAGAGTCAGGCTGG - Intronic
1029760301 7:102596937-102596959 TTTTTGAGACAGAGTCAGGCTGG - Intronic
1031886107 7:127247585-127247607 TTGGTGGGGCAGAGTGAGGATGG + Intronic
1032200465 7:129819043-129819065 TTTTTGAAGCTGATTAAGGCAGG + Intergenic
1033583071 7:142753980-142754002 TGGATGCAGCAGAGGGAGGCAGG + Intronic
1033584620 7:142764884-142764906 TGGATGCAGCAGAGGGAGGCAGG + Intergenic
1033623791 7:143088442-143088464 GAGCTGAAGCAGGGTGAGGCAGG + Intergenic
1033713975 7:143980747-143980769 TTGTTCAAGCAGAGTTTGGATGG + Intergenic
1034976747 7:155453645-155453667 TTGGGGAAGCAGAGTGGGCCAGG - Intergenic
1036037870 8:5040218-5040240 TTATGGATGCAGAGTGAGGTAGG + Intergenic
1036731733 8:11271533-11271555 TTGTTAAAGCACAGTAAGGAAGG + Intergenic
1038108295 8:24463309-24463331 TTGTTAAAGCACTGTAAGGCAGG + Intronic
1038379552 8:27079860-27079882 TACTTGAAGCAGAGAGAGGATGG - Intergenic
1039414759 8:37384465-37384487 TTTTTGAAGCTGACTGAGACAGG + Intergenic
1039907042 8:41794281-41794303 TGGTTGAAGCAGAGTGAGGCAGG - Intronic
1041098526 8:54373455-54373477 GTGTTGAAGGGGAGTGAGCCCGG + Intergenic
1042092901 8:65178451-65178473 TTGTTGAAGGAGAGTAAGAGAGG + Intergenic
1042222293 8:66485494-66485516 TGGTTGCAGAAGAATGAGGCAGG + Intronic
1044307614 8:90656223-90656245 TTGTTGAAGTATATTCAGGCTGG - Intronic
1046261234 8:111771140-111771162 TTGATCAAGGAGAATGAGGCAGG - Intergenic
1046533720 8:115481399-115481421 TTGTTGCAGAAGAGTGGGGGGGG - Intronic
1047274838 8:123397892-123397914 TTCTGGAAGAAGAGAGAGGCGGG + Intronic
1048043654 8:130753771-130753793 TTTCTGAAGCAGAGGGAGGCTGG - Intergenic
1048182891 8:132212749-132212771 GAGGTGAAGCAGAGTGAGGCGGG - Intronic
1049251963 8:141594015-141594037 TAGCTGGAGCAGAGTGAGCCAGG + Intergenic
1050016675 9:1241217-1241239 TGATTAAAGCAGAGAGAGGCTGG - Intergenic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1052224917 9:26074155-26074177 ATGTTGAATCAGAGTGAGAGAGG + Intergenic
1052380906 9:27770023-27770045 TTGTAGAAGCAAAGAAAGGCAGG + Intergenic
1053350407 9:37410312-37410334 TAGATGAGGCAGAGTGAGGGAGG + Intergenic
1054885426 9:70192701-70192723 TTGTTAAAGCACAGTAAGGCAGG + Intronic
1055155248 9:73054991-73055013 TTGGTGAAGCACTGTGAGGAGGG + Intronic
1055806758 9:80104443-80104465 TTCTTTAAGCAGTGTGAAGCTGG + Intergenic
1057775798 9:98008284-98008306 TTTTTGAAAGAGAGTGAGCCAGG + Intronic
1059393099 9:114011941-114011963 CTGTTGAAACAGAGTAAGTCTGG + Intronic
1059756045 9:117294403-117294425 TTGTTGAAGAGGAGAGAGGAGGG + Intronic
1061930311 9:133828991-133829013 CTGTGGGAGCAGAGTGGGGCTGG - Intronic
1062218270 9:135400682-135400704 TTGTGGATGCAAAGGGAGGCCGG + Intergenic
1062668593 9:137693170-137693192 TTGGAGACGCACAGTGAGGCCGG + Intronic
1187030640 X:15484609-15484631 TTCTTTAAGAAGATTGAGGCCGG - Intronic
1189289757 X:39876822-39876844 CTGTTGATGCAGAGAGAAGCAGG + Intergenic
1189943505 X:46152841-46152863 TTGTTGAAGCTGAGTGGAGGTGG + Intergenic
1190216093 X:48480402-48480424 TGGTTGGAACAGAGTGAGGGGGG + Intronic
1190393838 X:49959873-49959895 TTGCTGAAGCAGAGTGAAAATGG - Intronic
1190942616 X:55056880-55056902 TTCTAGAAACAGAGAGAGGCAGG + Intergenic
1192172988 X:68868239-68868261 GTGTGGAGGAAGAGTGAGGCTGG + Intergenic
1192722866 X:73718189-73718211 TTTTAGAATCAGAGTGATGCTGG + Intergenic
1194901485 X:99517364-99517386 TTTTTGTATCAGAGTGATGCTGG - Intergenic
1195005013 X:100677277-100677299 TGGTTGAAGCATAGTGAGCAAGG + Intronic
1196830611 X:119772786-119772808 TGGCTGGAGCAGAGTGAGGGAGG - Intergenic
1199791288 X:151157513-151157535 TTGGAGAAGCAGTGTGGGGCAGG + Intergenic
1200014479 X:153147886-153147908 AGGTTGAAGAAGAGTGGGGCTGG - Intergenic
1200025123 X:153252068-153252090 AGGTTGAAGAAGAGTGGGGCTGG + Intergenic
1200250103 X:154548217-154548239 TAGCTGGAGCAGAGTGAGGGAGG + Intronic