ID: 998672910

View in Genome Browser
Species Human (GRCh38)
Location 5:144373953-144373975
Sequence GAAACTGCAGTGATGCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 322}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998672910 Original CRISPR GAAACTGCAGTGATGCAGCT AGG (reversed) Intronic
900850654 1:5140039-5140061 GAAACTCAAGTGAGCCAGCTTGG - Intergenic
901687616 1:10952201-10952223 GAAGCTGCAGGGAAGCTGCTGGG + Intronic
903897559 1:26618387-26618409 GAAGCTGCAGTGAGCCAGGTTGG - Intergenic
904710418 1:32425947-32425969 GAAGTTGGAGTGAAGCAGCTAGG - Intergenic
904971189 1:34420642-34420664 GAATGTGCATTGATGCAGCCAGG - Intergenic
906152210 1:43594127-43594149 GCACCTGCTGTGCTGCAGCTGGG - Intronic
907043773 1:51286685-51286707 GAAACTGCATTCATGCATTTGGG + Intergenic
908859579 1:68468349-68468371 GAATCTGCATTGATGCAGGCAGG - Intergenic
909510344 1:76445952-76445974 GAAATTCCTGTGATGCAGTTGGG + Intronic
909626186 1:77718718-77718740 GAAAATGCAGAGATCCAGCCTGG + Intronic
910647742 1:89531676-89531698 GTATCTGCACTGATGCAGCCAGG - Intronic
910791931 1:91060440-91060462 GCAATTGGAGTGATGCACCTGGG + Intergenic
911307715 1:96251228-96251250 GAGACTGCAGTCAGGCTGCTAGG + Intergenic
912549436 1:110475504-110475526 GAAGCTGCAGAGATGAGGCTGGG + Intergenic
913097850 1:115536446-115536468 GAATCTACATTGATGCAGCCAGG - Intergenic
913955526 1:143287806-143287828 GAATCTGCCCTGATGCAGCCAGG + Intergenic
913981906 1:143527635-143527657 GAATCTGCCCTGATGCAGCCAGG - Intergenic
914044877 1:144083048-144083070 GAAACTGGAGTGATGGAGGAAGG - Intergenic
914076269 1:144354290-144354312 GAATCTGCCCTGATGCAGCCAGG - Intergenic
914102909 1:144612206-144612228 GAATCTGCCCTGATGCAGCCAGG + Intergenic
914133233 1:144877638-144877660 GAAACTGGAGTGATGGAGGAAGG + Intergenic
914198684 1:145465554-145465576 AAAACTGCAGTTTTGTAGCTTGG - Intergenic
914408516 1:147402100-147402122 GAATCTGCATTGATGCAGCCAGG - Intergenic
915360910 1:155285787-155285809 AGAACTGCAGTGACGAAGCTGGG - Exonic
915535187 1:156531085-156531107 GAAACAGCAGCGGTGCAGGTGGG + Intronic
923867935 1:237960577-237960599 GAATCTGCATTGATGCAGTCAGG + Intergenic
923894729 1:238257400-238257422 GAAACTCAAGGGATGCTGCTTGG - Intergenic
924859720 1:247908633-247908655 AAATCTGCATTGATGCAGCCAGG - Intergenic
1063438658 10:6054433-6054455 GACACTGCAGGGTTGAAGCTGGG + Intronic
1065090749 10:22230724-22230746 GAAAGTGGCGTGGTGCAGCTTGG - Intergenic
1065238227 10:23677060-23677082 TGAATTGAAGTGATGCAGCTAGG + Intergenic
1066952014 10:42128710-42128732 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1067224898 10:44369219-44369241 TAAGCTTCAGTGTTGCAGCTGGG + Intergenic
1067298327 10:44988717-44988739 GAGACTGTATGGATGCAGCTGGG + Intronic
1067511694 10:46900766-46900788 GAAACTGTAATGATGCACCAGGG - Intergenic
1067650552 10:48151059-48151081 GAAACTGTAATGATGCACCAGGG + Intergenic
1068644639 10:59451783-59451805 GAAATTAGAGTAATGCAGCTAGG + Intergenic
1068853415 10:61770761-61770783 GAACCTGCAGTGAAGAAGATTGG + Intergenic
1069565010 10:69458069-69458091 GAAACTGGAGTCAGGCAGCCTGG - Intronic
1070078098 10:73157786-73157808 GAAACAGCAGTGATGCATGTAGG - Intronic
1070271755 10:74963476-74963498 AAGGCTGCTGTGATGCAGCTGGG + Intronic
1070896289 10:79985153-79985175 GGAGCTGTAGTGATCCAGCTGGG + Intergenic
1071248767 10:83793438-83793460 GAAAATGCAGGGATTCATCTGGG - Intergenic
1071283949 10:84127031-84127053 GAAAGGGCAGAGATGCAGGTAGG - Intergenic
1072426218 10:95333099-95333121 AAATCTGCATTGATGCAGCCAGG + Intronic
1075388505 10:122075308-122075330 GCACCTGCACTGATGCAGCTTGG - Intronic
1076087629 10:127649101-127649123 GAAACTGCAGTCACTGAGCTGGG - Intergenic
1076134284 10:128034630-128034652 GAAACTGCAGTGAGCCAGTCTGG + Intronic
1076510397 10:131009899-131009921 AAAGCTGCAGTGATGCAGTGTGG - Intergenic
1077527053 11:3073297-3073319 GAAAATTCAGTGATGCAGGAGGG + Intergenic
1078737656 11:14035330-14035352 GAAACTACTGTAATGCAGATGGG - Intronic
1079948184 11:26769119-26769141 GAATCTGCATTGATGCATCCAGG + Intergenic
1080019830 11:27548908-27548930 GAAACGCCAGTGGTGCAGTTTGG + Intergenic
1082293347 11:50409047-50409069 GAAACTGCACTGATTCTTCTGGG - Intergenic
1083541690 11:63515907-63515929 GAAACTCAATTGATGCAGGTGGG + Intronic
1084872509 11:72107826-72107848 GGAGCTGCAGTGAGGCAGGTAGG + Intronic
1086244889 11:84740510-84740532 GGAACTGTATTGCTGCAGCTTGG - Intronic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1088102219 11:106168000-106168022 GAATCTTCATTGATGCAGCCAGG - Intergenic
1088779920 11:113123999-113124021 GACCCTGCAGTCATCCAGCTGGG + Intronic
1089270385 11:117297835-117297857 GAATCTGCATTGATGCAACCTGG - Intronic
1089840292 11:121411368-121411390 GAATCTGCATTGATGCAGCCAGG - Intergenic
1093727674 12:22533540-22533562 GAAACTGCAGGGAGGTGGCTGGG + Intronic
1094624155 12:32106934-32106956 GAGACTGCAGTGACGCGGCCCGG + Intronic
1095108981 12:38270516-38270538 GCAACTCCAGTCATGCAGATAGG + Intergenic
1096999026 12:55860177-55860199 GAATCTGCATTGATACAGCTTGG - Intergenic
1097599052 12:61669576-61669598 GAATCTGCATTGATGCAGCCAGG - Intergenic
1098313208 12:69167963-69167985 GAATCTCCATTGATGCAGCCAGG - Intergenic
1098959859 12:76728726-76728748 GAATCTGCATTGATGTAGCCGGG + Intergenic
1100009585 12:89937511-89937533 CCAACCGCAGTGGTGCAGCTTGG - Intergenic
1101220680 12:102636111-102636133 GATGTTGCAGTGATGCTGCTGGG + Intergenic
1101540705 12:105662430-105662452 GAGGGTGCAGTGATGCAGCTAGG + Intergenic
1101923474 12:108952112-108952134 GATTCTGCAGTGAGGCAGTTTGG - Intronic
1102627934 12:114251122-114251144 AAATCTGCATTGATGCAGCCAGG - Intergenic
1102718016 12:114990980-114991002 GAAACTTCAGTGAGGCTGGTGGG + Intergenic
1104669402 12:130670128-130670150 GACACTGGAGTGATGCTGCCAGG + Intronic
1105232931 13:18516481-18516503 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1106575246 13:30968405-30968427 GAATCTGCACTGATGAAGCCTGG - Intronic
1107655739 13:42590643-42590665 GTAACTGCAGTGTGGCATCTTGG - Intronic
1107962516 13:45571072-45571094 GGATAGGCAGTGATGCAGCTTGG - Intronic
1108523801 13:51268131-51268153 ACAACTGCAGGAATGCAGCTGGG - Intronic
1109475239 13:62872765-62872787 TAAACTGCAGTGATCTAGATTGG - Intergenic
1109561004 13:64050056-64050078 AAATCTGCATTGATGCAGCTAGG - Intergenic
1111466848 13:88624345-88624367 AGAATTGCAGTTATGCAGCTTGG + Intergenic
1112595192 13:100801470-100801492 GAATCTGCATTAATGCAGCCAGG - Intergenic
1114079730 14:19193543-19193565 GAAACTGCAGTGAGGCGGGATGG - Intergenic
1114757072 14:25271254-25271276 GAAACTATATTGATGCAACTAGG + Intergenic
1116091779 14:40317199-40317221 GAAAATGCTGTCAAGCAGCTTGG + Intergenic
1117242927 14:53853738-53853760 GAATCTGCAGTGATCCTCCTAGG - Intergenic
1119641192 14:76316167-76316189 GGAACTCCAGTGATGGAGTTTGG - Intronic
1119781463 14:77279010-77279032 GAAACTGGAGAGGAGCAGCTGGG + Intronic
1119788761 14:77330999-77331021 GAGACTGCCCTGATGCAGCAGGG - Intronic
1121122198 14:91383104-91383126 GAGGCTGCAGTGATGCAGGAAGG - Intronic
1202936108 14_KI270725v1_random:89046-89068 GAAACTGGAGTGATGGAGGTAGG + Intergenic
1202938040 14_KI270725v1_random:111334-111356 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1123395153 15:19926554-19926576 GAATCTGCCTTGATGCAGCAAGG - Intergenic
1124384521 15:29195386-29195408 GAAACTGCAGAGAGCCACCTCGG - Intronic
1124603774 15:31155312-31155334 GAGACTGCAGTGGGGGAGCTTGG + Intronic
1126128824 15:45320983-45321005 GAAACAGCAGTGTTGCAGTAGGG - Intergenic
1126260237 15:46681051-46681073 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1126683251 15:51224603-51224625 GCTACTGCAGTGATGCAGGAAGG - Intronic
1128695010 15:69755076-69755098 GAAACAGAAGTGATAGAGCTGGG - Intergenic
1129744265 15:78007343-78007365 GCAACTGCAGTGATGGAGACAGG + Intronic
1130026011 15:80271076-80271098 GCAGCTGGAGAGATGCAGCTAGG - Intergenic
1130724990 15:86429925-86429947 TAGCCTGCAGTGATGAAGCTTGG + Intronic
1131464719 15:92645920-92645942 AAAACTCCAGCCATGCAGCTGGG - Intronic
1131464997 15:92647796-92647818 GAATCTTCATTAATGCAGCTAGG + Intronic
1131505531 15:93014892-93014914 GACACTTCAGTAATGCAGGTAGG + Exonic
1132134273 15:99318932-99318954 GAAACTGGAGTGAATCAGTTTGG + Intronic
1132463227 16:65868-65890 GAAACAGCAGTGAGGCGGCTCGG + Intronic
1132768009 16:1544623-1544645 AGAAATGCAGTGATCCAGCTGGG - Intronic
1133968597 16:10550340-10550362 GAAAATGCAGTGTATCAGCTTGG - Intronic
1134604235 16:15557673-15557695 GAAACTGCAGTGCAGAAACTGGG + Intronic
1136282408 16:29221395-29221417 GAAACTGAAGTCATACACCTGGG - Intergenic
1136701256 16:32144984-32145006 GAATCTGCCATGATGCAGCCAGG - Intergenic
1136766405 16:32782478-32782500 GAATCTGCCATGATGCAGCCAGG + Intergenic
1136801693 16:33087900-33087922 GAATCTGCCATGATGCAGCCAGG - Intergenic
1136936218 16:34468078-34468100 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1136940259 16:34517913-34517935 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1136945506 16:34645875-34645897 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1136948432 16:34685022-34685044 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1136955831 16:34784896-34784918 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1136959561 16:34830656-34830678 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1136963602 16:34880492-34880514 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1136967745 16:34935023-34935045 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1137220455 16:46444583-46444605 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1138449685 16:57086211-57086233 GTAACTGCAGTTTTACAGCTTGG - Intergenic
1140544020 16:75788985-75789007 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1140609828 16:76584562-76584584 GCAGCTGCATGGATGCAGCTGGG - Intronic
1141404236 16:83777530-83777552 AAAACTGCTGAGAAGCAGCTTGG + Intronic
1141410151 16:83827684-83827706 GAGACTGGAGTGACGCAGCTGGG + Intergenic
1203068793 16_KI270728v1_random:1044728-1044750 GAATCTGCCATGATGCAGCCAGG + Intergenic
1142486484 17:250831-250853 GGTCCTGCAGTGATGGAGCTTGG - Intronic
1144223578 17:13122509-13122531 GAAACTGCAGTAAAACAGCAGGG - Intergenic
1145405415 17:22586197-22586219 CAATCTGCATTGATGCAGCCAGG - Intergenic
1145691776 17:26748959-26748981 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1145777157 17:27537159-27537181 CTAAGTGCAGTGGTGCAGCTGGG + Intronic
1146504951 17:33396775-33396797 GGAACTTCAGTGATGGAGATAGG + Intronic
1146933404 17:36793921-36793943 GAAACTTCAATGATGCATGTAGG + Intergenic
1203183296 17_KI270729v1_random:86504-86526 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1153350913 18:4080526-4080548 GAATCTGCATTGATGCAGCCAGG + Intronic
1154520373 18:15221975-15221997 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1155345029 18:24849296-24849318 AAAGCTGCAGGGATGCAGCTAGG + Intergenic
1155985002 18:32220615-32220637 GAAACTGCTGTGATTCTGCATGG - Intronic
1156401948 18:36747603-36747625 GACAGTGCTGTGATGGAGCTTGG - Intronic
1156573219 18:38282214-38282236 GAATCTCCATTAATGCAGCTAGG + Intergenic
1158386635 18:57000649-57000671 AAAACTGCAGTGATGCACACAGG + Intronic
1158870128 18:61678409-61678431 AAATCTGCATTGATGCAGCCAGG - Intergenic
1159206117 18:65255214-65255236 GAATCTGCACTAATGCAGCCTGG + Intergenic
1159619477 18:70620798-70620820 GACTCTGCATTGATGCAGCCAGG + Intergenic
1159734124 18:72073313-72073335 GAAAATGGAGTGATGCATTTTGG + Intergenic
1163626016 19:18390194-18390216 GAACCTGCAGTCATTCAGGTTGG - Intergenic
1166008085 19:39920873-39920895 GACACTGCAGTGATGGAGACAGG + Intronic
1166976731 19:46609302-46609324 GAAAGAGCAATCATGCAGCTTGG - Exonic
1167349852 19:48967857-48967879 GACACAGCAGTTTTGCAGCTTGG - Intergenic
1167388412 19:49178381-49178403 GAGACTGCAGTGATGGTGTTTGG + Intronic
1167743646 19:51339032-51339054 GGAACTGCAGGGAGGCAGCAGGG + Exonic
1202671410 1_KI270709v1_random:57050-57072 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1202681766 1_KI270712v1_random:11817-11839 GAAACTCCCTTGATGCAGCCAGG - Intergenic
1202684435 1_KI270712v1_random:36452-36474 GAAACTGGAGTGATGGAGGAAGG - Intergenic
925435097 2:3830202-3830224 GAAACTGCAGAGATGCATTTAGG - Intronic
925866983 2:8236749-8236771 GAATCTCCAGTGATGTAGCCAGG + Intergenic
926879890 2:17533207-17533229 GAAATTGCAGGGATGGAACTTGG - Intergenic
930380495 2:50621891-50621913 GAAACTGTAGTTATACAGCCGGG - Intronic
930901107 2:56508686-56508708 GAAACTGGATTGTTGCTGCTGGG - Intergenic
931289004 2:60856129-60856151 GAAAGAGAAGTAATGCAGCTAGG + Intergenic
931945172 2:67298515-67298537 TAATCTGCAGTGAAGCAGCAGGG - Intergenic
934247283 2:90318394-90318416 GAAACTGGAGTGATGGAGGAAGG + Intergenic
934250001 2:90343260-90343282 GAATCTGCCTTGATGCAGCCAGG + Intergenic
934259571 2:91460181-91460203 GAATCTGCCTTGATGCAGCCAGG - Intergenic
934262042 2:91484209-91484231 GAAACTGGAGTGATGGAGGAAGG - Intergenic
934302867 2:91792101-91792123 GAATCTGCCTTGATGCAGCCAGG - Intergenic
934305086 2:91815195-91815217 GAAACTGGAGTGATGGAGGAAGG - Intergenic
934328171 2:92037553-92037575 GAAACTGGAGTGATGGAGGAAGG + Intergenic
934330394 2:92060666-92060688 GAATCTGCCTTGATGCAGCCAGG + Intergenic
934466553 2:94268092-94268114 GAAACTGGAGTGATGGAGGAAGG + Intergenic
934468615 2:94290562-94290584 GAATCTGCCTTGATGCAGCCAGG + Intergenic
938120715 2:128631327-128631349 CCACCTGCAGTGATGCTGCTGGG - Intergenic
938137525 2:128771210-128771232 GAATCTGCATCGATGCAGCCAGG + Intergenic
938519730 2:132055750-132055772 GAATCTGCCTTGATGCAGCCAGG + Intergenic
940446613 2:153785110-153785132 GAAACAGCAAAGATGGAGCTTGG - Intergenic
942051888 2:172147739-172147761 GAATCTGCATTGATGCAGCCAGG - Intergenic
943571869 2:189582708-189582730 GATACTGCAGTGAAGCAAGTAGG + Intronic
944892475 2:204131667-204131689 CAAAATCCAGTGATGCAGTTTGG - Intergenic
945295244 2:208163896-208163918 GAAACTGCTGAGATGGAGGTTGG + Intergenic
945906293 2:215597265-215597287 GAATCTGTATTGATGCAGCCAGG - Intergenic
945979936 2:216301263-216301285 GGAACTGTGGTGTTGCAGCTGGG - Intronic
946084338 2:217156092-217156114 AAAGTGGCAGTGATGCAGCTTGG - Intergenic
947787408 2:232835982-232836004 CAAACAGCACTGATGCAGTTAGG + Intronic
947951368 2:234150382-234150404 GAAACTGCAGAGACCCTGCTGGG - Intergenic
948630545 2:239299853-239299875 GAGCCTGCAGGGACGCAGCTGGG + Intronic
948879105 2:240847061-240847083 AAACCTGCATTGATGCAGCCAGG - Intergenic
1169193327 20:3671034-3671056 CCATCTGCAGCGATGCAGCTGGG - Exonic
1169213831 20:3782714-3782736 GAACCTGCGGTGAGGTAGCTGGG + Intergenic
1169774235 20:9234950-9234972 GCAACTGCAGTAATGGAGTTTGG - Intronic
1170016624 20:11789151-11789173 AAATCTGCATTGATGCAGCATGG - Intergenic
1171314371 20:24176009-24176031 GAGACTGCAGTCATTCAGGTAGG - Intergenic
1171406546 20:24915663-24915685 GCAACTCCAGAGAGGCAGCTGGG + Intergenic
1171501352 20:25595916-25595938 GAAACTGCAGTGAGGAAACCTGG - Intergenic
1173921071 20:46745535-46745557 GAAACAGCAGAGATGAAGCAGGG + Intergenic
1175699663 20:61127831-61127853 GAGGCTGCAGTGATGCTGCCAGG + Intergenic
1176007793 20:62875582-62875604 GGAACTGCTGCCATGCAGCTGGG + Intergenic
1176585276 21:8577802-8577824 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1176776908 21:13144783-13144805 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1180268085 22:10554701-10554723 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1180280457 22:10688726-10688748 GAAACTGGAGTGATGGAGGTAGG + Intergenic
1180501041 22:15929157-15929179 GAAACTGCAGTGAGGCGGGATGG + Intergenic
1180524872 22:16248090-16248112 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1180587679 22:16907263-16907285 GAAACTGGAGTGATGGAGGAAGG + Intergenic
1181437487 22:22919067-22919089 GAGACTGCAATGATGGTGCTGGG + Intergenic
1182558126 22:31140135-31140157 GAGGCTGCAGTCATGTAGCTGGG - Exonic
1184066968 22:42126670-42126692 GAAGCTGAAGTGCTGCAGCAGGG + Exonic
1184069694 22:42140374-42140396 GAAGCTGAAGTGCTGCAGCAGGG + Intergenic
1184071437 22:42149982-42150004 GAAGCTGAAGTGCTGCAGCAGGG + Intergenic
1203237118 22_KI270732v1_random:14997-15019 GAATCTGCCTTGATGCAGCCAGG - Intergenic
949149380 3:746589-746611 GAAACTGCAGTGGTGACTCTAGG + Intergenic
949460487 3:4287729-4287751 TAAACTGCACTGAGGCACCTTGG - Intronic
949997023 3:9626222-9626244 GAAGCAGCAGTGTTGCAACTTGG + Intergenic
950595073 3:13972718-13972740 GCCACTGCAGTGAGGCAGCAGGG + Intronic
952171598 3:30812990-30813012 GAAAATGCAGTGAGGAAGCCTGG + Intronic
953838578 3:46369293-46369315 AGAACTGCAGTCATGCTGCTGGG - Intergenic
954856763 3:53650528-53650550 CAAAATGCAGTCATGCAGCCTGG + Intronic
955025969 3:55167819-55167841 CAAACTGCAGAGCTGCAGCTGGG + Intergenic
955446564 3:59017309-59017331 CAAGGGGCAGTGATGCAGCTGGG - Intronic
955791507 3:62593107-62593129 GAAACTGCAGTTGTACATCTTGG + Intronic
955998116 3:64699004-64699026 GATACTGCAGTGAGGAAGCTTGG - Intergenic
956176332 3:66476565-66476587 GGAACTGCAGTGTGGCATCTTGG - Intronic
957278711 3:78122581-78122603 GAAAGTGCAGGAATGCAGCTGGG - Intergenic
957686892 3:83513960-83513982 GAATCTCCATTAATGCAGCTAGG - Intergenic
958560981 3:95745580-95745602 TAAACTGCAGTGCTGGAGATGGG - Intergenic
958606399 3:96364110-96364132 GACACTGTACTGAAGCAGCTGGG - Intergenic
958717584 3:97804189-97804211 AAATCTGCACTGATGCAGCCAGG + Intergenic
960908706 3:122626987-122627009 GAAAGTTCAGTGATGCAGAGAGG - Exonic
961090977 3:124112556-124112578 GATACTCCAGTGGTGCAGTTGGG - Intronic
964527650 3:157632065-157632087 GAAACAGCAGTGATTAAGTTGGG - Intronic
965354334 3:167655338-167655360 TAAAGTGCAGTGATACAGTTGGG - Intergenic
965476327 3:169159757-169159779 GAATCTGCAGTGGGGCAGCCTGG + Intronic
966193763 3:177294176-177294198 GGAAGAGCAGAGATGCAGCTGGG + Intergenic
966425165 3:179773088-179773110 CAAACTGCAGTGTTGGAGGTGGG + Intronic
967248177 3:187509768-187509790 CAATCTGCACTGATGCAGCTGGG - Intergenic
967750893 3:193115119-193115141 GAATCTGCATTGATACAGCCAGG - Intergenic
969310233 4:6348650-6348672 GAAAAGGCTGGGATGCAGCTTGG + Intronic
970188382 4:13485628-13485650 TAAACTCCAGTGATGCCTCTAGG - Intergenic
971702645 4:29998619-29998641 GAAAATTCAGTGATGCTGCAGGG - Intergenic
971814784 4:31473687-31473709 GGAACTGCAGTAATGAAGCCTGG - Intergenic
976049701 4:80997444-80997466 GTGACTGCAGTTATGAAGCTGGG - Intergenic
978107409 4:104920094-104920116 GAAACTGCAGCTATATAGCTAGG + Intergenic
978597648 4:110395674-110395696 GAAAGTTCAGAAATGCAGCTTGG - Intronic
978840775 4:113209368-113209390 GAATCTGCATTGATGCAGCCAGG - Intronic
981218560 4:142203062-142203084 GAAACTCCATTGATTCAGCTTGG + Intronic
983669778 4:170222901-170222923 GAGACTGCAGTGATCCAGGATGG - Intergenic
984141262 4:176006057-176006079 AAACCTGCATTGATGCAGCCAGG - Intergenic
985319595 4:188695115-188695137 GCAATTTCAGGGATGCAGCTTGG + Intergenic
986280705 5:6319764-6319786 GCAACTGCAGTTATCCAGCAAGG - Intergenic
986509457 5:8488690-8488712 GAATCTGCAGTGATGCAGCCAGG - Intergenic
987033847 5:14000261-14000283 GTGACTGGAGTGATGCAGCTAGG + Intergenic
987229383 5:15877469-15877491 GAGACTGAAGAGATGCAGTTGGG + Intronic
987795904 5:22626250-22626272 GAAGCTGCAGTGATGCATCAGGG - Intronic
987841499 5:23227632-23227654 GTAACTGCAGTAATGAAGGTTGG + Intergenic
989599473 5:43188164-43188186 GAAAGGCCAGGGATGCAGCTTGG + Intronic
990024829 5:51173531-51173553 GAAAGGGCAGTGATGCAGATTGG - Intergenic
991601426 5:68354971-68354993 GAAACTGCGGTGATGTAGGTTGG + Intergenic
992091073 5:73317490-73317512 GAAACTGCCTTGATTCACCTAGG - Intergenic
992450436 5:76871267-76871289 GAATCTCCATTAATGCAGCTAGG + Intronic
992754906 5:79895109-79895131 GAATCTCCATTTATGCAGCTAGG - Intergenic
993313020 5:86360953-86360975 GAAACTGCAATGATTCAGGTAGG - Intergenic
993415955 5:87631273-87631295 ACAACTGCAATGACGCAGCTTGG + Intergenic
993982532 5:94559943-94559965 GAATCTGCATTAATGCAGCCAGG + Intronic
995882366 5:116857423-116857445 GAATCTGCAGTGATGCTTCCAGG + Intergenic
998672910 5:144373953-144373975 GAAACTGCAGTGATGCAGCTAGG - Intronic
1000614145 5:163409339-163409361 GAATCTACATTAATGCAGCTAGG + Intergenic
1001873429 5:175178628-175178650 GAATCTGCATTGATGCAGTCTGG - Intergenic
1003129081 6:3379756-3379778 CAAACAGAAGTCATGCAGCTGGG + Intronic
1003743342 6:8968776-8968798 GAGACTGCAGTGCTCTAGCTGGG + Intergenic
1003946874 6:11084139-11084161 GAGATTGGAGTGATGCAGCTTGG + Intergenic
1004733740 6:18384327-18384349 GAAACAGAAGTGATGGAACTTGG - Intergenic
1007020853 6:38519772-38519794 GAAATGGCAGGGATGCAGCTAGG - Intronic
1007377075 6:41464281-41464303 GAGACTGCAGTGGTGCACCCTGG - Intergenic
1007687693 6:43676789-43676811 AAATCTGCAGTTATGCAGCAAGG - Intronic
1007976140 6:46103403-46103425 CAATCTGCACTGATGCAGCTAGG + Intergenic
1009459423 6:63894391-63894413 GAAACTGGAGTGATGCTGCTAGG + Intronic
1014710146 6:124796774-124796796 GAAAAGGCAGTGATACATCTTGG + Intronic
1015014203 6:128390603-128390625 TCAACTGCAGTGATGAAGCACGG + Intronic
1015128947 6:129788037-129788059 TAACCTGAAGTGATTCAGCTAGG + Intergenic
1015477565 6:133670643-133670665 GAAGCTGCAGTGGTGCAACTTGG + Intergenic
1016217822 6:141624601-141624623 GAACTTGCAGTGATGCAGCAAGG - Intergenic
1016573984 6:145547069-145547091 GAAACTGCAGTATTCCAGCATGG - Intronic
1020344167 7:7145344-7145366 GAAACTGCAAGGAGGCAGCCTGG - Intergenic
1022359894 7:29647873-29647895 GGAGCTGTAGTGATCCAGCTGGG - Intergenic
1022368701 7:29750539-29750561 GGAGCTGTAGTGATCCAGCTGGG - Intergenic
1023673527 7:42605274-42605296 GAAAATGCAGTGCTTCAGGTGGG + Intergenic
1023816628 7:43955560-43955582 GCAACTGCAGTGAGGCAGTGTGG - Exonic
1024817955 7:53293570-53293592 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1025474062 7:60897575-60897597 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1025488693 7:61084119-61084141 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1025512940 7:61592299-61592321 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1025885749 7:65589738-65589760 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1026561944 7:71457651-71457673 TAAACTGCAGTGGTGCTGGTGGG + Intronic
1029668297 7:102010097-102010119 GAAACAGCAAGGGTGCAGCTGGG + Intronic
1030116109 7:106063477-106063499 GAATCTGCATTGATGCAGCCAGG - Intergenic
1031388070 7:121177672-121177694 GAAAGTGCTGTACTGCAGCTTGG + Intronic
1031417665 7:121512007-121512029 GAATGTGCATTGATGCAGCCAGG + Intergenic
1034164538 7:149015180-149015202 AAAACTGCAGAGATGCAGCCAGG - Intronic
1034889292 7:154825690-154825712 GAAACAGCAGTGTGGCAGTTGGG - Intronic
1034974991 7:155443082-155443104 GAGACTAGAGTGATGCAGCTGGG + Intergenic
1035257775 7:157642915-157642937 TAAGCTGCTGTGATGCAGCTTGG - Intronic
1035882247 8:3255586-3255608 CAAACTGCAGGGCTGCAGCAAGG - Intronic
1037543954 8:19899540-19899562 GAATCTGCATTGAGGCAGCCAGG - Intergenic
1039759944 8:40563843-40563865 GAAACTGGGGTGATGCTGGTAGG + Intronic
1041153480 8:54960361-54960383 GAAGCTGTAGTGATGCAGACAGG + Intergenic
1041805004 8:61840407-61840429 GAATCAGCATTGATGCAGCCAGG + Intergenic
1042344118 8:67710354-67710376 GAATCTACATTAATGCAGCTGGG - Intronic
1043660022 8:82727620-82727642 GAAACAACATGGATGCAGCTAGG + Intergenic
1044121415 8:88401154-88401176 GAAACTGCACTGAAGAAGCCTGG - Intergenic
1044946654 8:97395941-97395963 GGAAATACAGTGAAGCAGCTTGG - Intergenic
1045269085 8:100646499-100646521 GAATCTGTATTGATGCAGCCAGG - Intronic
1045886570 8:107105687-107105709 GCAGCTGCAGTGCTGTAGCTTGG - Intergenic
1046849694 8:118958166-118958188 GAAACTGCGGTGATGAAAGTAGG - Intergenic
1047026347 8:120828713-120828735 TCAACTGCAGTGATCAAGCTAGG + Intergenic
1047330756 8:123884732-123884754 GACCCTGCAGTGAGGCAGCTTGG + Intronic
1047771793 8:128035808-128035830 GAGATTGTAGTGATGCAGCCAGG + Intergenic
1049469327 8:142768460-142768482 GGAAGAGCAGTGAGGCAGCTTGG + Intronic
1049652934 8:143783294-143783316 AAAACTGCAGTGAGGCACCACGG - Intergenic
1050564933 9:6872247-6872269 GAAATTGGAGTGATACTGCTGGG + Intronic
1051629737 9:19130286-19130308 AAATCTGCATTGATGCAGCCAGG + Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053696599 9:40644863-40644885 GAAACTGGAGTGATGGAGGAAGG + Intergenic
1053699012 9:40668586-40668608 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1053943021 9:43275073-43275095 GAAACTGGAGTGATGGAGGAAGG + Intergenic
1053945019 9:43298827-43298849 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1054307849 9:63444091-63444113 GAAACTGGAGTGATGGAGGAAGG + Intergenic
1054310301 9:63467987-63468009 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1054406575 9:64768093-64768115 GAAACTGGAGTGATGGAGGAAGG + Intergenic
1054409090 9:64792136-64792158 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1054440205 9:65253566-65253588 GAAACTGGAGTGATGGAGGAAGG + Intergenic
1054442250 9:65275953-65275975 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1054488031 9:65745544-65745566 GAATCTGCCTTGATGCAGCCAGG - Intergenic
1054490200 9:65768373-65768395 GAAACTGGAGTGATGGAGGAAGG - Intergenic
1056348464 9:85723419-85723441 CAACCTGCAATGCTGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057032168 9:91784157-91784179 GAATCAGCACTGTTGCAGCTGGG - Intronic
1057282637 9:93723793-93723815 GAGACTGGAGTGATGCCTCTAGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058639334 9:107067762-107067784 GCAACTCCAGGGATGCTGCTTGG + Intergenic
1059083233 9:111272478-111272500 GAAAGTGGAGTGATTTAGCTAGG - Intergenic
1062569793 9:137179782-137179804 GTCACTGCAGGGAGGCAGCTAGG - Intronic
1202779049 9_KI270717v1_random:18523-18545 GAAACTGGAGTGATGGAGGAAGG + Intergenic
1203586118 Un_KI270747v1:4932-4954 GAAACTGGAGTGATGGAGGAAGG + Intergenic
1203588154 Un_KI270747v1:27405-27427 GAATCTGCCTTGATGCAGCCAGG + Intergenic
1185524552 X:766868-766890 GAGGCTGCAGTGAGGCAGCCAGG + Intergenic
1186218165 X:7322370-7322392 GAATCTGCATTGAGGCAGCCAGG - Intronic
1186830295 X:13383469-13383491 AAATCTGCACTGATGCAGCCAGG - Intergenic
1187848510 X:23566376-23566398 GAAACTGCAGTGCGGCAGCGAGG - Intergenic
1188296075 X:28450771-28450793 GAAACAACCTTGATGCAGCTAGG + Intergenic
1189144559 X:38642717-38642739 TAGACTGCAGTGATGCTGCTTGG + Intronic
1189226708 X:39419392-39419414 GAAGCTCCAGTGATCCTGCTGGG + Intergenic
1189246028 X:39564227-39564249 GAGATTGGAGTGATGCATCTAGG - Intergenic
1189683815 X:43543262-43543284 AAATCTGCATTGATGCAGCTAGG + Intergenic
1190742589 X:53299682-53299704 CCATCTGCAGGGATGCAGCTGGG + Intronic
1192160414 X:68782218-68782240 GAATCTGCACTGATGCAGCCAGG - Intergenic
1192161433 X:68791131-68791153 GAATCTGCACTGATGCAGCCAGG + Intergenic
1192231493 X:69268170-69268192 GAATCTGCATTGATGCAGCCAGG - Intergenic
1192239305 X:69316742-69316764 GAATCTGCATTGATGCAGCCAGG + Intergenic
1192790974 X:74381584-74381606 GAATCTGCATTGATGCAGCCAGG + Intergenic
1194018975 X:88663520-88663542 GAAACTGCAGTGATGTTAATTGG - Intergenic
1194803011 X:98294522-98294544 GAATCTCCATTAATGCAGCTAGG - Intergenic
1196366237 X:114927443-114927465 GAATCTACATTGATGCAGCCAGG - Intergenic
1196796123 X:119503284-119503306 GCAACTGCTCTGATGCAGTTGGG - Intergenic
1197652805 X:129084391-129084413 GAATCTGCATTGATGAAGCCAGG + Intergenic
1199091359 X:143696864-143696886 GAAAATGCTGTAATGCAGCATGG - Intergenic
1199767837 X:150953730-150953752 GACCCTGCAGGGAGGCAGCTGGG - Intergenic
1200846933 Y:7839819-7839841 GAAACAGTAGTGGGGCAGCTTGG - Intergenic
1201194334 Y:11476797-11476819 GAAACTGGAGTGATGGAGGAAGG + Intergenic