ID: 998675287

View in Genome Browser
Species Human (GRCh38)
Location 5:144401007-144401029
Sequence CAAAGTTTGGAAAGGTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 318}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998675280_998675287 9 Left 998675280 5:144400975-144400997 CCAGGGCAATTGGGGCAAAATCA 0: 1
1: 0
2: 1
3: 17
4: 148
Right 998675287 5:144401007-144401029 CAAAGTTTGGAAAGGTAGGCAGG 0: 1
1: 0
2: 1
3: 34
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998675287 Original CRISPR CAAAGTTTGGAAAGGTAGGC AGG Intronic
900480551 1:2896062-2896084 CAAAGTGTGGCAGGGCAGGCTGG + Intergenic
902634068 1:17723783-17723805 CACAGTTGGGAACGGTAGGACGG + Intergenic
902775351 1:18671106-18671128 CACAGCTTGGAAAGGCTGGCAGG - Intronic
902813236 1:18901508-18901530 CTAGGTTTGGAGAGGTAGGTGGG - Intronic
903839942 1:26231780-26231802 CTAAGTTTGGGGAGGAAGGCAGG + Intergenic
903840186 1:26233633-26233655 CCAAGTTTGGGGAGGGAGGCAGG + Intergenic
903874524 1:26464287-26464309 AAAAGTTTGCAAATATAGGCCGG - Intronic
904177979 1:28644779-28644801 ATGAGTTTGGAGAGGTAGGCAGG + Intergenic
905223983 1:36467456-36467478 CAAAGTTTGGGAAGGCTGGAAGG + Intronic
906061989 1:42954869-42954891 CCAAATTCAGAAAGGTAGGCAGG + Intronic
906163375 1:43667843-43667865 CAAACTTTGGAAAGCTGGGAAGG + Exonic
908793319 1:67804650-67804672 CAAAAGTTGGAGAGATAGGCAGG + Intronic
909339954 1:74520558-74520580 AAAATTTTGGAAAGGGAGGAAGG - Intronic
910953493 1:92676341-92676363 CAAAGTTTAAAAAGGGAGGAGGG + Intronic
912160010 1:106970842-106970864 CACAGTTTGGAAAGGCAGTGTGG + Intergenic
913566656 1:120079547-120079569 CAAAGTTTTGAAAGGGATGTGGG + Intergenic
913631475 1:120714005-120714027 CAAAGTTTTGAAAGGGATGTGGG - Intergenic
914905800 1:151742547-151742569 GAAAGGTTGGAGAGGTAGCCAGG + Intergenic
915707086 1:157854996-157855018 CACAGTTTGGAAATGTAAACTGG - Intronic
916546333 1:165808416-165808438 CAAAATTTGGAAATTTTGGCCGG - Intronic
917453708 1:175167992-175168014 CAAGGTTTGGACAGGCAGGGTGG - Intronic
918088013 1:181261864-181261886 CAGAGTTTGGTAGGGGAGGCAGG - Intergenic
919929740 1:202213577-202213599 TAAAGTTAGGAAAGATAGGCTGG - Intronic
920361231 1:205417913-205417935 CAAAGTTTGGAGAGCCAGACTGG + Intronic
920903196 1:210132934-210132956 CAAAGTGTGGAAATGAAGTCAGG - Intronic
921394086 1:214650327-214650349 CAAAGATTGGAGGGGTAGGAAGG + Intronic
924082779 1:240416566-240416588 CAAAGAATGGAAAGGGAGGCTGG - Intronic
1063796540 10:9519278-9519300 AAAAGTTTGGAAAGAAAGGATGG - Intergenic
1066752073 10:38668278-38668300 CAGAGTTTGGAACAGTTGGCAGG - Intergenic
1067983524 10:51115470-51115492 CAAATTTGGGAGAGGTAGGATGG + Intronic
1068151390 10:53136764-53136786 CAATTTCTGGAAAGGTAGGTGGG + Intergenic
1068362364 10:55994335-55994357 AAAAGTTTAGAAAGGTGTGCTGG - Intergenic
1068763224 10:60734636-60734658 CAAAATTTCAAAAGGTAGGCAGG + Intergenic
1069095134 10:64249988-64250010 CAAAGGTTGGAATGGTTTGCGGG - Intergenic
1069444957 10:68464535-68464557 CAAAAACTGGTAAGGTAGGCCGG + Intronic
1070906200 10:80075595-80075617 AAACTTTTGGTAAGGTAGGCTGG + Intergenic
1071024729 10:81099214-81099236 AGAAGTTTAGAAAGGGAGGCCGG + Intergenic
1071703922 10:87976114-87976136 TAAATTTTGGAGAAGTAGGCAGG + Intergenic
1072724319 10:97802244-97802266 GGAAGTTTGGAAAGGTAGCGTGG - Intergenic
1078955401 11:16188765-16188787 CAAAATTTGAAGAGATAGGCTGG + Intronic
1080620218 11:33981075-33981097 AAATGACTGGAAAGGTAGGCAGG - Intergenic
1081445642 11:43129304-43129326 CATAATTTGGAAAGGCAGGTTGG - Intergenic
1083871260 11:65489841-65489863 CAGAGTAGGGAAAGGAAGGCCGG - Intergenic
1084138891 11:67209897-67209919 CAAAATTTGGAAACTTAGCCAGG + Intronic
1084493513 11:69490835-69490857 CAGAGTCTGGAAAGGGAGGTGGG - Intergenic
1088109325 11:106244232-106244254 AAATGTTTGGAAAGGTAGGCAGG + Intergenic
1089226075 11:116923421-116923443 CTAATTTTGGAGAGGTAGGTTGG - Intronic
1090675021 11:128984075-128984097 CAAAATTGGAAAAGGAAGGCCGG + Intronic
1091178578 11:133582799-133582821 CAAAGTCTGGAAAGGTGAGCAGG + Intergenic
1091227928 11:133968906-133968928 CAAATTTTTGAGATGTAGGCAGG + Intergenic
1091265061 11:134264046-134264068 TAAAATTAGGAAAAGTAGGCTGG + Intronic
1091738933 12:2946144-2946166 CAAAGTGAGGAAAGGGAGGTAGG - Intergenic
1091915010 12:4265501-4265523 CAATGTTTTGGAAGGTAGACAGG - Intergenic
1092404574 12:8210011-8210033 CAAGGTTGGGGAAGGAAGGCCGG - Intergenic
1093842352 12:23919570-23919592 TAAAGATTTGATAGGTAGGCAGG - Intronic
1093932249 12:24966115-24966137 AAAAGTAGGGAAAGATAGGCTGG - Intergenic
1095039909 12:37429159-37429181 CAAAAAGTGGAAAGATAGGCTGG - Intergenic
1095189874 12:39245294-39245316 CAAATTATCAAAAGGTAGGCAGG + Intergenic
1095610036 12:44117079-44117101 CAAAAAGTGGAAATGTAGGCGGG - Intronic
1096242799 12:49968247-49968269 CAAAACCTGGAAAGGTAGGGAGG - Intronic
1099553193 12:84073865-84073887 CAAAGTTTGGCCAAGAAGGCTGG + Intergenic
1102760140 12:115377629-115377651 CAGAGGTTGGAAAGGTGGGGTGG - Intergenic
1103126667 12:118429112-118429134 CAAAATGGAGAAAGGTAGGCTGG - Intergenic
1103768556 12:123301301-123301323 AAATGTTTTAAAAGGTAGGCTGG - Intronic
1104052876 12:125208226-125208248 CAGAGTTGGGGAAGGTGGGCAGG + Intronic
1106581961 13:31026528-31026550 CAAAGGCTGGAAAGGTAGAAGGG - Intergenic
1106651476 13:31694930-31694952 AATTGGTTGGAAAGGTAGGCTGG - Intergenic
1107686279 13:42902679-42902701 CAACAATTGCAAAGGTAGGCAGG + Intronic
1107744107 13:43486874-43486896 AAAAGTTAGGAAATGTTGGCGGG + Intronic
1108536934 13:51392453-51392475 CTAGGTTTAGAGAGGTAGGCAGG - Intronic
1109764916 13:66882425-66882447 GAAAATTTGGAAAGGTAGAGAGG - Intronic
1111240697 13:85470759-85470781 GCAAGTTTGGAGAGGTGGGCAGG + Intergenic
1111973776 13:94944760-94944782 TGATGCTTGGAAAGGTAGGCGGG - Intergenic
1112026755 13:95418599-95418621 CAAATTTTAGAAAGGTAAGACGG + Intergenic
1112532832 13:100221514-100221536 GAAAATATGGAAAGGTAGACAGG + Intronic
1112553193 13:100442305-100442327 CACAGTTTGTAAAGGAAGGAAGG - Intronic
1112604715 13:100892843-100892865 CTATGTCTGGAAAGGTTGGCAGG - Intergenic
1112759453 13:102677490-102677512 ATAAGTCTGGAGAGGTAGGCAGG - Intronic
1112923969 13:104650397-104650419 CAAAGAATGCAATGGTAGGCCGG - Intergenic
1113017616 13:105845324-105845346 AAGAGCTTGGAAAGGCAGGCTGG - Intergenic
1115039548 14:28906965-28906987 CTATGTTTGGAAAATTAGGCAGG + Intergenic
1115530690 14:34324179-34324201 TAAAGAATGGATAGGTAGGCTGG - Intronic
1115840585 14:37465164-37465186 CAAAGTTCGGAAAGGCAGCATGG - Intronic
1117051801 14:51867680-51867702 CAAAGTGTGGAAGGGGAAGCAGG - Intronic
1118575144 14:67234844-67234866 TAAAGTGTGGAACTGTAGGCCGG - Intergenic
1118713396 14:68540911-68540933 TGAAGTTTGGAAAGAGAGGCAGG + Intronic
1118824383 14:69367155-69367177 CTGAGTTTTGACAGGTAGGCAGG + Intergenic
1118882371 14:69840559-69840581 CTAAGTTTGGAATTGTAGGGAGG - Intergenic
1119375401 14:74187221-74187243 TAAAGTTTGGAAATGGGGGCTGG + Intronic
1119402948 14:74376703-74376725 AAAAGCTTGGAAAGATGGGCCGG + Intergenic
1123739092 15:23217742-23217764 AAAAGTTTGGCAAAGTAGGCCGG - Intergenic
1124199512 15:27666278-27666300 CCAAATTTTGAAAGGCAGGCTGG - Intergenic
1124290310 15:28446698-28446720 AAAAGTTTGGCAAAGTAGGCCGG - Intergenic
1124292927 15:28470850-28470872 AAAAGTTTGGCAAAGTAGGCCGG + Intergenic
1125857652 15:42965761-42965783 TAAATTTTGGACATGTAGGCCGG - Intronic
1127366146 15:58292438-58292460 CAAAGTCAGGAAGTGTAGGCTGG + Intronic
1127433767 15:58936508-58936530 AAAAGTTTCAAAATGTAGGCCGG - Intronic
1127560373 15:60130380-60130402 CATAATTTGTAAAGGTAGGAAGG - Intergenic
1128265431 15:66262339-66262361 AAAAGGTTGGAAAGGTGAGCTGG + Intergenic
1129084074 15:73069797-73069819 CAGAGTTTAGTAAGGTAGGTAGG + Intronic
1129320244 15:74770760-74770782 CAAAGTGAGGACAGGTAGGAAGG - Intergenic
1129510789 15:76120462-76120484 AAAAGTAAGGAAAGATAGGCCGG + Intronic
1129712386 15:77826960-77826982 CAGAGTTTGGAAAGGGGGGCAGG - Intergenic
1130073508 15:80669087-80669109 AAGAGTTTGTAAAGGTAGGGAGG - Intergenic
1131039196 15:89246478-89246500 GGAAGTCTGGAAAGATAGGCTGG - Intronic
1131571282 15:93539426-93539448 CAAAAATTAGAAAGCTAGGCTGG - Intergenic
1131664188 15:94552535-94552557 AAAAGTCTGGAAAGGAAGGTAGG - Intergenic
1131857749 15:96616798-96616820 AAGAGTTTGGAAAGGGAGGAAGG - Intergenic
1134635272 16:15786973-15786995 CAAAGAGTGAAAAGGTGGGCCGG + Intronic
1135486240 16:22868109-22868131 AAAAGTCTGGAAAGATAGGCTGG + Intronic
1135566990 16:23518562-23518584 CAAAGCTTGGAAGTGAAGGCTGG - Intronic
1135703865 16:24657412-24657434 CAAAGTTTGGAAATAAAGGCCGG + Intergenic
1136018730 16:27425850-27425872 TAAAGTTAAGAAAGGGAGGCCGG - Intronic
1136708424 16:32210912-32210934 AAAAGTTTGGCAAAGTAGGCCGG + Intergenic
1136759479 16:32718497-32718519 AAAAGTTTGGCAAAGTAGGCCGG - Intergenic
1136808625 16:33151889-33151911 AAAAGTTTGGCAAAGTAGGCCGG + Intergenic
1138104805 16:54282328-54282350 CAAACTTGGGCAAGGTTGGCTGG + Intergenic
1138194193 16:55040486-55040508 CAAAGCTAGGAAAGGTGGGAGGG - Intergenic
1139263646 16:65619969-65619991 CAAAATATGTAAAGGCAGGCAGG - Intergenic
1140085183 16:71789270-71789292 CTCACTTTGGACAGGTAGGCTGG - Exonic
1140907308 16:79419846-79419868 CAAAGTTTGCAAAGTAAGGGTGG - Intergenic
1141384420 16:83606439-83606461 AAAAGTTTGGAAGTGAAGGCTGG + Intronic
1203061634 16_KI270728v1_random:978805-978827 AAAAGTTTGGCAAAGTAGGCCGG - Intergenic
1143675211 17:8427402-8427424 CAAAGTCTTGGAAGGGAGGCTGG + Intronic
1144415376 17:15041522-15041544 CATAGGTTGGCATGGTAGGCAGG - Intergenic
1144436679 17:15248788-15248810 CTAAGTTTTGAAAGTTAAGCAGG - Intronic
1144697457 17:17314663-17314685 CAGAGGTTGGAAAGGAAGGCAGG - Intronic
1145037680 17:19552716-19552738 CCAAGGTTGGGAAGGAAGGCAGG + Intronic
1145223241 17:21106291-21106313 GACAGTTTGAAAGGGTAGGCTGG - Intergenic
1145262807 17:21364891-21364913 CAAAGTTTCAAAAGGCAGCCTGG - Intergenic
1147862033 17:43529462-43529484 TAAACTTTGGAAAGGAGGGCTGG + Intronic
1148637066 17:49156937-49156959 TAAAGTGGGGAAAGGAAGGCAGG - Intronic
1149009625 17:51841850-51841872 CAAAACTTGGAAAGGAAGACAGG - Intronic
1153610812 18:6882968-6882990 AAAAGTTTGGAAAAGTAGAATGG + Intronic
1155080750 18:22407660-22407682 CGCAGTTTGGAAAAGTAGGAAGG - Intergenic
1155490500 18:26396703-26396725 CAAATTTTGGAAATGTAAGATGG + Intergenic
1157333232 18:46718700-46718722 AACAGTTTGGAAAGGAAGTCAGG - Intronic
1158551572 18:58440465-58440487 CAAAGTTTGGCAATGGAGCCCGG + Intergenic
1159825340 18:73201984-73202006 GAAAGCTGGGGAAGGTAGGCCGG - Intronic
1160854067 19:1208071-1208093 CAAAGTTTTGAAAGTTAAGAAGG - Intronic
1162859949 19:13499047-13499069 CAAAGTTTGGAAGGGGAGGGGGG + Intronic
1163363867 19:16865391-16865413 CTAACTATGGAAAGGAAGGCAGG - Exonic
1164570311 19:29369896-29369918 CAGAGGTAGGAAAGGAAGGCAGG + Intergenic
1165335432 19:35166511-35166533 CACAGTTTGGAAACATAGGCTGG + Intronic
1165551936 19:36594258-36594280 CAAAGTTTGGAAGAGCATGCAGG - Intronic
1167236080 19:48316395-48316417 CACAGTTTGCACAGTTAGGCAGG - Intronic
1167381389 19:49140226-49140248 CACAGCTTGCCAAGGTAGGCGGG + Intronic
1167508648 19:49884207-49884229 CAAAGGTGAGAAAGGTAGGGGGG - Intronic
1167815208 19:51874556-51874578 AAAAGTTTGGCAAGGCTGGCAGG + Intronic
925076244 2:1018585-1018607 GAAAGTTTGGAAAAGGAGGAAGG + Intronic
927070523 2:19524188-19524210 CTGAGGCTGGAAAGGTAGGCAGG - Intergenic
928344727 2:30481079-30481101 CAAAGTCTGAGAAGGTAGCCTGG + Intronic
928358801 2:30646213-30646235 CAAAGTTGGGAAAGGGAGAGGGG - Intergenic
929282818 2:40100954-40100976 CAAAGTATGTAAAAGGAGGCTGG - Intronic
929365742 2:41154525-41154547 CAAAGATTGGAAAGATAGGAGGG + Intergenic
932885176 2:75542840-75542862 ATAATTTTGGAAAGGTAGGTTGG + Intronic
933452027 2:82467040-82467062 AAAAGTTTACAAATGTAGGCCGG + Intergenic
934041265 2:88129404-88129426 AAAAGGATGGAAAGGTAGACTGG - Intergenic
935017634 2:99199168-99199190 CAAAGTATGGAAAGGAAGGAAGG - Intronic
935447038 2:103167778-103167800 CACAGGCTGGAAAGGCAGGCAGG - Intergenic
935705223 2:105851008-105851030 CACAGGTTGGAAAGGCTGGCTGG - Intronic
935785425 2:106544499-106544521 CAGTGTCTGGAAAGGTAGCCTGG - Intergenic
936498077 2:113039979-113040001 GAAAGTTTCGTAAGGTGGGCAGG + Intronic
936599043 2:113877440-113877462 CATACTTTGGAAAGAGAGGCCGG - Intergenic
937683501 2:124669683-124669705 CAAAGTTTGGGAAAGAATGCTGG - Intronic
939792203 2:146591644-146591666 CAATATTTGGAAAGATAGGCTGG + Intergenic
940511014 2:154615009-154615031 CCAAGGTTGGAAAGGTATTCAGG - Intergenic
942018080 2:171837320-171837342 CATGGTTTGGAAAGGAAGGAAGG + Intronic
944278313 2:197865337-197865359 AATAGTTTGGAAAGGTGAGCTGG - Intronic
945117684 2:206425221-206425243 GAAAATATAGAAAGGTAGGCCGG + Intergenic
945818968 2:214639399-214639421 ATAAGGTTGGAAAGGTAAGCTGG + Intergenic
945982737 2:216327113-216327135 CAAAATTTAAAAAGGGAGGCAGG - Intronic
947591050 2:231386102-231386124 CAAAGCCTGCAAAGGTTGGCAGG - Intergenic
947687240 2:232098648-232098670 CAAAAATTAGAAAGCTAGGCTGG - Intronic
1169466018 20:5839705-5839727 CAAAGTTTGGGAAGCTATGTTGG - Intronic
1170227335 20:14005894-14005916 AAAAGTTTGGAAAAAGAGGCAGG - Intronic
1171123925 20:22585922-22585944 CCAATTTTGGACAGGTGGGCTGG - Intergenic
1171362865 20:24602073-24602095 CAAAGCTTGGAAGTGTTGGCAGG - Intronic
1171525304 20:25804694-25804716 CAAAAAGTGGAAAGATAGGCTGG - Intronic
1171551523 20:26051190-26051212 CAAAAAGTGGAAAGATAGGCTGG + Intergenic
1171571692 20:26257245-26257267 CAAAAAGTGGAAAGATAGGCTGG - Intergenic
1171792644 20:29542490-29542512 CAAAAAGTGGAAAGATAGGCTGG + Intergenic
1171855824 20:30341912-30341934 CAAAAAGTGGAAAGATAGGCTGG - Intergenic
1173162851 20:40664933-40664955 CAGAGTCTGGGAAGGGAGGCTGG + Intergenic
1174272003 20:49376426-49376448 CAAATTTCTCAAAGGTAGGCTGG - Intronic
1174280508 20:49435576-49435598 CAAATCTTGGAAAGGTGGGCAGG + Intronic
1174610457 20:51793922-51793944 CAGAGTTAAGAAAGCTAGGCAGG + Intronic
1175424025 20:58853124-58853146 CAAGGGTTGGAAAGTGAGGCCGG + Exonic
1176998631 21:15584723-15584745 CGGAGTTTGGTATGGTAGGCAGG - Intergenic
1177760343 21:25395901-25395923 AGAAATTTGGAAAAGTAGGCTGG - Intergenic
1178331535 21:31699002-31699024 CAAAGTTTGAAAAAGTATGAGGG + Intronic
1178452783 21:32719411-32719433 CAAGGTTTGAAAAGCTATGCAGG + Intronic
1179681825 21:43027608-43027630 CACAGGTTGGCAAGGCAGGCTGG - Intronic
1180573876 22:16754270-16754292 CAAAAAGTGGAAAGATAGGCTGG - Intergenic
1181237351 22:21455704-21455726 CAGGGTTGGGAAAGGCAGGCAGG + Intergenic
1181829153 22:25545574-25545596 CAAAGTTTGGATAGGAAGTGTGG - Intergenic
949108657 3:231450-231472 CAAAGTTTGCAAAGTAAGACTGG + Intronic
949497314 3:4644780-4644802 CAGAGCTTGGAAAGGCAGACAGG - Intronic
949607480 3:5670192-5670214 CAAAATTTGGTGAAGTAGGCTGG + Intergenic
949785306 3:7733762-7733784 TCAAGGCTGGAAAGGTAGGCAGG - Intronic
950715892 3:14847705-14847727 CAAGTTTTGGAAATCTAGGCAGG + Intronic
951354672 3:21650087-21650109 CAAAGATGTGAAAGGAAGGCAGG + Intronic
951530567 3:23694482-23694504 CAATGCTTGGGAAGGAAGGCAGG + Intergenic
952077869 3:29720068-29720090 GTGACTTTGGAAAGGTAGGCAGG - Intronic
952330616 3:32361300-32361322 CAAATTTTGGAAAGGTAATAAGG + Intronic
953158276 3:40394740-40394762 CACAGGATGGAAAGGTAGGGAGG + Intronic
953536599 3:43781862-43781884 GAAATTCTGGAGAGGTAGGCAGG - Intergenic
955617056 3:60820587-60820609 CAAAATTTGCAAAGTTGGGCAGG - Intronic
958943735 3:100341148-100341170 CAAAGTATAGAAAGGTAAGTAGG + Exonic
958965040 3:100549533-100549555 CAATGTTTGGACAGGGAGGCTGG + Intronic
959214196 3:103428684-103428706 CAAATGTTGCAAAGGTAGGAAGG - Intergenic
959924933 3:111910411-111910433 CCTAGTTTGGAAAGGTGGGTAGG + Intronic
961656966 3:128448177-128448199 AAAAGAGTGGGAAGGTAGGCTGG - Intergenic
961756073 3:129128113-129128135 CAAAGTATGGAAGGTGAGGCTGG + Intronic
962204435 3:133423511-133423533 CAAAGTACGGAAAAGTTGGCTGG - Intronic
962219359 3:133550802-133550824 CCAAGTTTGGAAAGTTGGGCAGG - Intergenic
964434085 3:156634130-156634152 CAAAGGATCCAAAGGTAGGCTGG + Intergenic
964650802 3:159009206-159009228 GAAAGTCTGGAAAGGTAAGAAGG - Intronic
965294523 3:166926578-166926600 GAAAGTTTTGAGATGTAGGCTGG + Intergenic
967025214 3:185558705-185558727 CCAAGTTTGGAAAGATAAGTGGG + Intergenic
969124336 4:4935352-4935374 CTGAGATTGGAAGGGTAGGCAGG - Intergenic
969275251 4:6130381-6130403 CAACATTTGGAAAGGCAGACAGG + Intronic
969670604 4:8588027-8588049 CAAACCATGGAAAGGAAGGCAGG - Intronic
970252745 4:14133835-14133857 AAAAATTTGGAAAGGTAAGTGGG - Intergenic
973202656 4:47521704-47521726 CAAAGATAAAAAAGGTAGGCAGG - Intronic
973233974 4:47876533-47876555 GAAAGTTGGGAAAGATAGTCAGG + Intronic
973876564 4:55225823-55225845 CTGAGATAGGAAAGGTAGGCTGG - Intergenic
974179335 4:58363686-58363708 AAAATTTGGGAAAGGTAGGGTGG + Intergenic
974936910 4:68419870-68419892 ATAAGTGTGGAAAGGTAGGTAGG + Intergenic
978113327 4:104989146-104989168 AAAAGTTGGGAAAAGTAGTCAGG + Intergenic
978254021 4:106671676-106671698 CAGAGTTTGGAAAAGTCTGCAGG - Intergenic
978505145 4:109448727-109448749 CAAAGTTTCGGAAGACAGGCTGG - Intronic
980850125 4:138371243-138371265 AAAAGTTTGGAAAGCCAGGTTGG + Intergenic
981530104 4:145744208-145744230 AAATGGTTGGTAAGGTAGGCTGG + Intronic
981585968 4:146302705-146302727 CAGAGGTCAGAAAGGTAGGCAGG + Intronic
982216562 4:153087430-153087452 GGAGGTTTGGAGAGGTAGGCAGG + Intergenic
982474054 4:155828426-155828448 CAATATTTGGATAAGTAGGCCGG + Intergenic
982487818 4:155989143-155989165 GAAAGTCTGGAAAAATAGGCTGG - Intergenic
983861250 4:172709633-172709655 CACACTGTGGGAAGGTAGGCAGG - Intronic
984407906 4:179357297-179357319 CAAAGATTGAATATGTAGGCTGG + Intergenic
984430596 4:179643414-179643436 CAAAGTTTGGGAAGCTTGTCTGG + Intergenic
987331696 5:16862975-16862997 CAAAGACTGGAAGGATAGGCCGG + Intronic
987906948 5:24089557-24089579 CAAAGGTTGGAACAGTTGGCAGG - Intronic
990045968 5:51431834-51431856 GAAAGTTTGGACAGTTATGCAGG + Intergenic
990567961 5:57048987-57049009 ATAAGTTTGGAAAGGTAGTTTGG - Intergenic
990867094 5:60391634-60391656 CAATATTTTAAAAGGTAGGCAGG - Intronic
991315591 5:65301417-65301439 AAAAGTCTGGAAAGGTAGTTGGG + Intronic
994238686 5:97394354-97394376 CAAAATTTGGCCAGGTAGACAGG + Intergenic
994955725 5:106529213-106529235 TAAAGTATGGAAAGGTGGGAAGG + Intergenic
997190777 5:131932941-131932963 CAAAGTTTGGAAGGTTAATCAGG - Intronic
997959665 5:138310001-138310023 GAAAGTTTTGAGAGCTAGGCTGG - Intronic
998675287 5:144401007-144401029 CAAAGTTTGGAAAGGTAGGCAGG + Intronic
999478454 5:151923787-151923809 CAGAGTTTGGAAAGGTGGGTTGG + Intronic
999883116 5:155889667-155889689 GAATGATTGGAAAGGTAGTCAGG + Intronic
1000088383 5:157908796-157908818 CATAGTCTGGAGAGGTAGGGAGG + Intergenic
1000792171 5:165621454-165621476 TAAAGATTGGAAAGGGAAGCTGG + Intergenic
1001536390 5:172501170-172501192 CAAAGATTTGAAAGGTAAGAAGG + Intergenic
1003216751 6:4120428-4120450 CAAACATAGAAAAGGTAGGCCGG + Intronic
1005290451 6:24374270-24374292 CAACAATTGGAAAGGTAGCCAGG + Intergenic
1005334680 6:24782564-24782586 CAAAATTAGGAAAGGTTGACTGG + Intronic
1006242373 6:32695561-32695583 CAGAGGTTGGAAAGGTAGTGGGG + Intergenic
1006628697 6:35415861-35415883 CCAAATTTTGAAAGGCAGGCAGG + Intronic
1008518505 6:52340827-52340849 AAAATGTTGAAAAGGTAGGCTGG - Intergenic
1009474585 6:64074104-64074126 TAAAGTTTTGAAATGTAGTCTGG - Intronic
1009624283 6:66118462-66118484 CAAAGGGTGGAAAGGAAAGCGGG + Intergenic
1010582524 6:77617339-77617361 TAAAGTTTGGAAAAGGAGTCTGG - Intergenic
1011003981 6:82623127-82623149 CAAAGTTTAGAAATGTAGGTGGG - Intergenic
1012045256 6:94264569-94264591 AAAAGTTTGGAAAATTTGGCAGG - Intergenic
1012867213 6:104632750-104632772 CAATGTTTGGACGGGGAGGCGGG + Intergenic
1013295076 6:108751747-108751769 CAAAGTGAGCAAAAGTAGGCTGG + Intergenic
1013415871 6:109924046-109924068 CAAAGTTTAGGAAGGAAAGCTGG + Intergenic
1013903951 6:115192161-115192183 CAAATTTTGGAAAGAAAGCCAGG - Intergenic
1017193515 6:151677798-151677820 CAGAGTTTGCAAAGGGAGGAGGG + Intronic
1017328250 6:153165298-153165320 CACATTTTGGAAAGCAAGGCAGG - Intergenic
1017673770 6:156793494-156793516 AAAAATTTTGAAAAGTAGGCAGG - Intronic
1017869420 6:158474249-158474271 CAAAGGGTGGAGAGGGAGGCTGG + Intronic
1018966313 6:168492323-168492345 AAAACTATGGAAAGGTAGGTGGG - Intronic
1019070083 6:169338298-169338320 CAAAGTTTGGCAAGCCAGCCAGG - Intergenic
1020031846 7:4938909-4938931 CAAAGTTGGGGAGGGGAGGCTGG + Intronic
1020051247 7:5083158-5083180 CAAAGTTAGGAAAGGAAGAGGGG + Intergenic
1021270347 7:18577249-18577271 GAAAGGTCAGAAAGGTAGGCAGG - Intronic
1023515510 7:40997447-40997469 CAAAGCTTAGAATGTTAGGCAGG - Intergenic
1023932377 7:44713675-44713697 CCAACTTTGGAAATCTAGGCAGG - Intergenic
1025300174 7:57813468-57813490 CAAAAAGTGGAAAGATAGGCTGG + Intergenic
1026473596 7:70715446-70715468 CAAACCTTGGGAAGGTAGGAGGG - Intronic
1026586347 7:71659139-71659161 AAAATATTGGAGAGGTAGGCAGG - Intronic
1027168298 7:75851833-75851855 CAAAGATGGGAACGATAGGCCGG - Intronic
1028810034 7:95075532-95075554 TAAAGTATGGAGAGGTAGGCTGG + Intronic
1030464171 7:109878731-109878753 CAGAGTTAGGAAAGCTAGGATGG + Intergenic
1030891827 7:115007993-115008015 CAAAGTCTAGGAAGTTAGGCTGG - Intronic
1031125751 7:117771823-117771845 CAAAGTGTGGAGAGGTATCCTGG + Intronic
1032431847 7:131868589-131868611 CAATGTTTGGATAGGTAGACAGG - Intergenic
1032512920 7:132486442-132486464 CTGAGTTGGGAAAGGAAGGCTGG - Intronic
1033476552 7:141698634-141698656 CAAGTTTTGGAAAGCTAGGCTGG - Intronic
1034630666 7:152528181-152528203 GAAAGAATGGAAAGGGAGGCTGG + Intergenic
1035675102 8:1450610-1450632 CAAAGTTTGGAAAGGAAAAAAGG - Intergenic
1036513664 8:9423368-9423390 CAATGGTTGGCAAGGTATGCTGG - Intergenic
1037684677 8:21128875-21128897 CCAAGGGTGGAAAGGTAAGCAGG - Intergenic
1038499541 8:28032121-28032143 CAGAGGTTGGAAAGGCAAGCTGG + Intronic
1039593644 8:38771081-38771103 AAAAGTTTGGCAAGGTTGTCAGG + Intronic
1040934308 8:52766956-52766978 CACAGTTTGGACACATAGGCAGG + Intergenic
1041354872 8:56989799-56989821 AAGAGATTGGAAAGGTAGGTAGG - Intronic
1042420701 8:68585313-68585335 AAAAGCTTTGAAAGGTAGGAAGG + Intronic
1043045190 8:75314331-75314353 CTAAGATGGGAAAGGAAGGCAGG - Intergenic
1043530174 8:81140924-81140946 CATAGTTTGGAAAGCAAGACTGG + Intergenic
1044405953 8:91826270-91826292 AAAAGTTTGGATAGTTAGGAGGG - Intergenic
1044506381 8:93024713-93024735 CAAACTGTGGAAACGTAGCCAGG - Intergenic
1044759083 8:95498100-95498122 CAAATATTGGAAGGGTAGTCAGG - Intergenic
1045578397 8:103450760-103450782 CACAGATTGGACAGGAAGGCTGG - Intergenic
1046872435 8:119218454-119218476 AAGAATCTGGAAAGGTAGGCAGG - Intronic
1047284496 8:123475445-123475467 CAGAGTTTGGAAATATATGCAGG + Intergenic
1051310070 9:15760754-15760776 CAAAGTTTAGGAAGGTAGCTGGG - Intronic
1051665255 9:19462711-19462733 GAAAGACTGGAAAGGAAGGCAGG - Intergenic
1052372253 9:27678376-27678398 CAAAATTTGGAAAGGAAGGAAGG + Intergenic
1053446682 9:38158479-38158501 CAAACTTTAGAAACATAGGCAGG - Intergenic
1056467785 9:86875778-86875800 CAATGTTGGGAAAAGTAGACAGG - Intergenic
1056918837 9:90768403-90768425 TAAAGTTTGGTCAGGTAGACAGG - Intergenic
1057586491 9:96333298-96333320 AAAAGTATGGAATTGTAGGCCGG + Intronic
1058445010 9:105047062-105047084 CAAAATGTGGAAAGAGAGGCTGG - Intergenic
1061300613 9:129702855-129702877 CAAAGTGTGGCAAGGGGGGCGGG + Intronic
1061747696 9:132752543-132752565 AAAAGTTAGAAAATGTAGGCCGG - Intronic
1062074879 9:134581519-134581541 TACAGTTTGGAAAGGTATGGTGG - Intergenic
1062635503 9:137488523-137488545 CAAAGGATGGAGAGGAAGGCAGG + Intronic
1185812964 X:3127794-3127816 CCAAGTTTGGAAAGGAAGGAAGG + Intergenic
1186963573 X:14763063-14763085 CTGAGCTTGGAAAGGTAGGCTGG + Intergenic
1187551119 X:20306839-20306861 CAGAGCTTGGACACGTAGGCAGG - Intergenic
1188332369 X:28891082-28891104 CAAAGTTTGCAAATGCAGACAGG + Intronic
1188520111 X:31029424-31029446 CTGAGTTGGGGAAGGTAGGCAGG + Intergenic
1188534642 X:31183022-31183044 CAATGGTTGCAAAGCTAGGCTGG + Intronic
1188752879 X:33925110-33925132 CAAAGTTGGGAAATGTAAGGTGG + Intergenic
1189128594 X:38475011-38475033 AAAAGTCTGGAGAGGAAGGCAGG - Intronic
1189642600 X:43088851-43088873 CGAAGTTTGGCAATGGAGGCAGG + Intergenic
1190908872 X:54754094-54754116 CAAAGACTGGAGAGCTAGGCAGG - Intronic
1191652228 X:63551922-63551944 CACAATTTGTAAAGGTAGCCTGG + Intergenic
1192753171 X:74016307-74016329 GAAAGTTTAGAGAAGTAGGCCGG + Intergenic
1193096319 X:77553522-77553544 TAAAGACTGGAAAGGTAGGTGGG - Intronic
1194488869 X:94522067-94522089 CAACGACTGGAAAAGTAGGCAGG - Intergenic
1195284857 X:103374804-103374826 AAAGGTTTGGAAAGGAAAGCAGG + Intergenic
1195422678 X:104693261-104693283 CAAAGATTGGCAAGATTGGCTGG + Intronic
1195647303 X:107246818-107246840 GTAAGTTTGGAAATGTAGGCTGG + Intergenic
1196097773 X:111818007-111818029 CAAAGCTCAGAAAGGTTGGCAGG - Intronic
1196850086 X:119929190-119929212 CAAGGATTGGAAAGGAAGGCTGG - Intronic
1197834137 X:130676750-130676772 AAAGGTTTGAAAAAGTAGGCTGG - Intronic
1197853830 X:130893520-130893542 CAAAGATTAGAAAGGTAGGTTGG + Intronic
1198311103 X:135426257-135426279 CAAGGTTGGGAAAGGGAAGCAGG - Intergenic
1198429862 X:136554439-136554461 AGAAGTCTGGAGAGGTAGGCAGG + Intronic
1199190979 X:144970669-144970691 CAAATTTTAGAAATTTAGGCTGG + Intergenic
1199433981 X:147792522-147792544 CAAACTTTGGAAAAGAATGCAGG + Intergenic
1199861867 X:151808186-151808208 CGCAGTCTGGAAAGGTTGGCAGG + Intergenic
1200311695 X:155085054-155085076 GTAATTTTGGAAAGATAGGCTGG + Intronic
1201786255 Y:17784358-17784380 TAAAGTTTGGTCAAGTAGGCAGG - Intergenic
1201815298 Y:18121630-18121652 TAAAGTTTGGTCAAGTAGGCAGG + Intergenic
1202329727 Y:23735791-23735813 TAAAGTTTGAACAAGTAGGCAGG - Intergenic
1202541043 Y:25934263-25934285 TAAAGTTTGAACAAGTAGGCAGG + Intergenic