ID: 998680115

View in Genome Browser
Species Human (GRCh38)
Location 5:144457693-144457715
Sequence CAATATCACAACATATATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998680115 Original CRISPR CAATATCACAACATATATAT TGG (reversed) Intronic
901142773 1:7045873-7045895 CCATATCAAAACATCTAAATCGG - Intronic
902211299 1:14906599-14906621 CAATATCACAAAACATATAAAGG + Intronic
903096785 1:20984131-20984153 CAATATAACTACATATTTAGTGG - Intronic
903367150 1:22812117-22812139 CCATTTCACAACAAATATCTGGG - Intronic
907016458 1:51019194-51019216 AAATATCACAACAGTTATACAGG + Intergenic
907765045 1:57401238-57401260 CAATTTCACAACAACTATATAGG + Intronic
907801939 1:57776743-57776765 CAATATTACAACAGATAGAAGGG - Intronic
908289054 1:62642630-62642652 CAATAACACAATGTATAAATTGG - Intronic
910151678 1:84155278-84155300 CAATATCACAAAAAATGCATAGG + Intronic
911688509 1:100804399-100804421 CATTATCACAAGTAATATATAGG - Intergenic
911819810 1:102403196-102403218 CTATAGCACAACTGATATATGGG + Intergenic
911994563 1:104748927-104748949 CAATATAACAATATATTTTTAGG + Intergenic
912592055 1:110833087-110833109 CAATATCACAACCAAAATATTGG + Intergenic
912991307 1:114489413-114489435 CAAAAGCACAAAATATAAATTGG + Intronic
913175854 1:116272698-116272720 CAATATCTGTACATATTTATGGG + Intergenic
915743053 1:158134442-158134464 CAATGGCACAAGATATACATTGG - Intergenic
916680704 1:167102498-167102520 AAATAATACAACATATATAAAGG + Intronic
918692179 1:187495164-187495186 CAATATCACAATGTTTAGATTGG + Intergenic
918895169 1:190333790-190333812 AAAGATCACAAGATATAGATTGG - Intronic
919104751 1:193135338-193135360 TACTATTTCAACATATATATTGG - Intronic
919113259 1:193246683-193246705 CAATAGAACAGAATATATATGGG - Intronic
919519110 1:198565138-198565160 CAGAAAAACAACATATATATTGG - Intergenic
920670039 1:207996749-207996771 CATTCTCACAACACATACATAGG - Intergenic
920999985 1:211034517-211034539 CAATATCACAACCTGGATATTGG - Intronic
921120810 1:212135327-212135349 CAATATCACAACCAGGATATGGG - Intergenic
923135659 1:231116183-231116205 CAATATCACAACTGAGATGTTGG - Intergenic
924642162 1:245844401-245844423 AAAAATCATAACATATATCTGGG - Intronic
1063820377 10:9828006-9828028 CAATGTCACAAAAGATATAAAGG + Intergenic
1064110785 10:12536941-12536963 AAATATCACAACGTATCTAGAGG - Intronic
1066330470 10:34416181-34416203 CAAAATCACAAGATGTAAATGGG + Intronic
1067398240 10:45944409-45944431 CTATAAGACATCATATATATGGG + Intergenic
1067514285 10:46923896-46923918 AAATATAACAAAATATATACAGG - Intronic
1067647970 10:48127913-48127935 AAATATAACAAAATATATACAGG + Intergenic
1067866559 10:49913494-49913516 CTATAAGACATCATATATATGGG + Intronic
1068003363 10:51363370-51363392 CAATATCAAAGTATATACATAGG - Intronic
1068420235 10:56781626-56781648 ATATAGCACAAAATATATATAGG + Intergenic
1069325046 10:67223273-67223295 CACTACCACAACATACATTTAGG - Intronic
1071070772 10:81690883-81690905 CAATATCAGAACCAAGATATTGG + Intergenic
1071237602 10:83667318-83667340 CCATATAACAACATATTCATAGG - Intergenic
1071675606 10:87652848-87652870 CATTATAAAAACATAAATATTGG - Intergenic
1071861884 10:89682548-89682570 CAATATTTGAAAATATATATAGG + Intergenic
1072390669 10:94982728-94982750 CAACATCAGATTATATATATTGG + Intronic
1072557085 10:96527293-96527315 AAATAAAACAAAATATATATAGG + Intronic
1075309688 10:121403238-121403260 AAATAACAAAACATATATATTGG + Intergenic
1079759174 11:24307628-24307650 CAATATAAGAACAGATATCTGGG - Intergenic
1079960001 11:26912361-26912383 CAATATCACAACATTCACATAGG + Intergenic
1081149355 11:39607178-39607200 TAATTTGACAACATATATAGTGG - Intergenic
1081384075 11:42450036-42450058 ATATATCATAACATATTTATAGG - Intergenic
1081440663 11:43077217-43077239 CAATATCACAATTTACTTATTGG - Intergenic
1082756532 11:57082177-57082199 CAAAATCTCATCATATACATAGG - Intergenic
1083076692 11:60047395-60047417 AAATATTAGAACATATTTATTGG - Exonic
1084299481 11:68237703-68237725 GAATCTAACAACGTATATATAGG - Intergenic
1086347866 11:85915793-85915815 CAAAATGACAACATATACTTAGG + Intronic
1086584254 11:88433267-88433289 CAAAATCACAACATATGTTGGGG + Intergenic
1086613255 11:88782611-88782633 CCATATCACCTTATATATATTGG + Intronic
1086742779 11:90388015-90388037 CAAAATCAAAGCATATCTATTGG - Intergenic
1088451913 11:109990548-109990570 CAATAACACATTATATATGTAGG - Intergenic
1088769608 11:113020499-113020521 AAATATAACAAAATATATAAGGG - Intronic
1089513180 11:119013934-119013956 AAATACCACTACATATGTATTGG + Intronic
1092830353 12:12438605-12438627 AAATTTCCCATCATATATATTGG - Intronic
1092969935 12:13683770-13683792 CAAGCTCTCAACATATATAAAGG + Intronic
1093291519 12:17330146-17330168 GAAAATCACAAAATATAGATGGG + Intergenic
1094238671 12:28197461-28197483 CAATAAAACAACATACATAAAGG - Intronic
1094294055 12:28883713-28883735 CAAAATCACAACATTTATAAGGG - Intergenic
1095745651 12:45655499-45655521 CAAAATCACAAGATATAAAAAGG - Intergenic
1099281969 12:80661413-80661435 CAAAATTACAATATATATATTGG - Intronic
1101463238 12:104918903-104918925 CAATATCACAACCAAGATATTGG + Intronic
1103000300 12:117380554-117380576 CAGTATGACAACGTATATAATGG - Intronic
1106217292 13:27714567-27714589 CACTATAACAGCATATATGTGGG + Intergenic
1107747597 13:43527333-43527355 CAATGTCACAACAACTACATAGG + Intronic
1107956923 13:45523655-45523677 CAATTTCATAACATAGATTTAGG - Intronic
1108889203 13:55232196-55232218 CAGTATCATGACATATTTATAGG + Intergenic
1109074395 13:57815798-57815820 CAAAGTCATAACATAAATATAGG + Intergenic
1109817194 13:67600014-67600036 CAAAAACAGAAAATATATATTGG + Intergenic
1109981954 13:69920556-69920578 CAATATAACAATGTATAAATGGG + Intronic
1110013600 13:70370815-70370837 TAATAGCACAAGTTATATATTGG + Intergenic
1110208926 13:72949687-72949709 CAAATACACAACATATATTTGGG - Intronic
1113065161 13:106365965-106365987 CAATATAAAAAAATATATATTGG - Intergenic
1114919130 14:27304848-27304870 TATTATTATAACATATATATGGG + Intergenic
1115134538 14:30092920-30092942 CAATATCAAATCAGAGATATTGG - Intronic
1115205840 14:30903155-30903177 AAATATCAAAACAAATAAATGGG + Intronic
1115208908 14:30944940-30944962 CAATATCATAAAATACATCTAGG + Intronic
1115838312 14:37435109-37435131 TAATATCACAACATACATCTGGG - Intronic
1116025247 14:39506837-39506859 CAATCTCAAAATATATATATAGG - Intergenic
1116132573 14:40875695-40875717 CAATATCACAACCAGAATATTGG - Intergenic
1117414483 14:55480984-55481006 CTGTCTCAAAACATATATATAGG - Intergenic
1118313819 14:64712132-64712154 AAATAAAACAACATATTTATTGG - Intronic
1118544476 14:66871571-66871593 CAAAATCATAACAGATAGATTGG + Intronic
1120204470 14:81573098-81573120 CAATTTCACCACATATAGAGAGG - Intergenic
1120287015 14:82516237-82516259 GAATAACACCACATATTTATTGG - Intergenic
1120328630 14:83059106-83059128 CCATATGACAACGTATATCTAGG + Intergenic
1120674034 14:87398389-87398411 CAATTTCACATTATATATAAAGG - Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1125187234 15:36945011-36945033 TAATATCACAACATATTTCCTGG + Intronic
1125276780 15:38001847-38001869 CAATATAATAAGATATAAATAGG - Intergenic
1125531705 15:40417879-40417901 GAAAAAAACAACATATATATGGG + Intronic
1126159577 15:45597583-45597605 AAATATAACAAAATATATACAGG - Intronic
1126213196 15:46123563-46123585 CAATATCATAAAAAATATATAGG - Intergenic
1127037512 15:54934225-54934247 CAAAATGACGACACATATATAGG + Intergenic
1128481544 15:68044451-68044473 CAATATCACAACCAAAAAATTGG + Intergenic
1128841681 15:70855497-70855519 CTATATCAAAACAAATGTATTGG - Intronic
1129127925 15:73461650-73461672 CAATAGCACAACCTATATATTGG - Intronic
1129201301 15:74002823-74002845 CCCCATCAAAACATATATATAGG + Intronic
1129553524 15:76479857-76479879 CAATTTCACAAAATCTACATGGG + Intronic
1130200177 15:81818648-81818670 CAATGTGATAACAGATATATAGG + Intergenic
1133289544 16:4710372-4710394 CAAAATAACTACATATTTATGGG - Intronic
1133546033 16:6808086-6808108 CAATAGAACTAGATATATATAGG + Intronic
1136649824 16:31659617-31659639 AAATATTACAACATATGAATTGG - Intergenic
1137471665 16:48765224-48765246 TAATATCAGACCAAATATATAGG + Intergenic
1139233816 16:65313445-65313467 CAATATCTCATCATATATAATGG + Intergenic
1140610096 16:76588192-76588214 AACTCTCACAACATATTTATGGG + Intronic
1140642917 16:76998234-76998256 CATTATCACAACCTACACATGGG + Intergenic
1203013152 16_KI270728v1_random:320329-320351 CAATATCTCAAGATATAAACTGG + Intergenic
1203031487 16_KI270728v1_random:593488-593510 CAATATCTCAAGATATAAACTGG + Intergenic
1203040234 16_KI270728v1_random:740943-740965 CAATATCTCAAGATATAAACTGG - Intergenic
1144393848 17:14824090-14824112 CAGTATCACAGCATATCTGTTGG + Intergenic
1147499328 17:40947610-40947632 CAAAACCAGAACATAGATATAGG - Intergenic
1148041764 17:44712992-44713014 CAAAATTACTACATATATACTGG - Intronic
1148827112 17:50401916-50401938 CAGAATCACAACATAGAGATTGG - Intergenic
1150340333 17:64361444-64361466 TAATTTAAAAACATATATATTGG - Intronic
1150969132 17:70007247-70007269 CATTATCAGTTCATATATATGGG + Intergenic
1155556622 18:27026813-27026835 CAATATAAGAACAGATATACTGG - Intronic
1155765942 18:29632836-29632858 TAATATTACAAAATATATAAGGG - Intergenic
1155832012 18:30528122-30528144 TAATATAACAAGATAAATATTGG - Intergenic
1157008949 18:43623016-43623038 CAAGTTCACAACATATTTAATGG + Intergenic
1158433327 18:57412776-57412798 AAATGTAACAAAATATATATAGG + Intergenic
1158975467 18:62707584-62707606 CAATTTTACAACAGAGATATGGG + Intergenic
1159273512 18:66185754-66185776 GAATATCTCAACATGTAGATTGG - Intergenic
1163051034 19:14683739-14683761 CAACATCACATGATAAATATGGG + Intronic
1164074987 19:21807128-21807150 CAACATCAGAAAATTTATATTGG - Intronic
1166415752 19:42593925-42593947 CAATATTGCAACATATGTATTGG + Intronic
1166495987 19:43303561-43303583 CAATATCAAAACCTATGTATTGG + Intergenic
926375895 2:12227154-12227176 CAATATGACTACATACATAATGG - Intergenic
927309130 2:21608448-21608470 CACTATCATACCATATAGATAGG - Intergenic
928489046 2:31762166-31762188 CAAGATTTCAACATATAAATTGG + Intergenic
928613237 2:33011065-33011087 CAGTATCACAACCAATATAGTGG - Intronic
929626027 2:43407921-43407943 CATTATCACAACAAAAAAATTGG - Intronic
930307085 2:49688089-49688111 AAATATCACATCATTTATAATGG - Intergenic
931016381 2:57985525-57985547 TAATATAATATCATATATATAGG - Intronic
933118842 2:78509794-78509816 CAAGAAAACAACAAATATATGGG - Intergenic
935493458 2:103748715-103748737 GAATATCACAACTTAAGTATGGG + Intergenic
938176094 2:129131057-129131079 CAATTGCACAAAATATATAGTGG + Intergenic
939554192 2:143654755-143654777 TAATATCACAATATACATAGAGG - Intronic
940159647 2:150697533-150697555 CACTATCACAACGAATATCTTGG - Intergenic
940297868 2:152147466-152147488 CTATATCACAACATGTAAATAGG - Intronic
940425609 2:153527733-153527755 CAGTATCATAAGATATAAATGGG + Intergenic
943168878 2:184370362-184370384 CAATATCAGAGAATATATTTGGG + Intergenic
944003469 2:194871982-194872004 CCATATCCTGACATATATATTGG - Intergenic
946066954 2:216996202-216996224 AAATTTAACAACATAAATATTGG + Intergenic
947044327 2:225962641-225962663 CAATATCACAACCAGTATATTGG - Intergenic
947176109 2:227368980-227369002 AAATATCAAAACACTTATATAGG - Intronic
1169963761 20:11192238-11192260 TAATATATCAACAAATATATTGG - Intergenic
1170740973 20:19056314-19056336 AGATACCACTACATATATATTGG + Intergenic
1177583286 21:23056217-23056239 CAATATAACAACTTATTCATTGG + Intergenic
1181294672 22:21826945-21826967 CATTATCAAAGCATATATGTAGG - Intronic
1181367034 22:22385634-22385656 CGATATCACAAGTTGTATATGGG - Intergenic
1183161935 22:36120109-36120131 CAATATCACAACCAGGATATTGG - Intergenic
1185049864 22:48548403-48548425 CAATCTCAAAAAATATATACTGG - Intronic
950211778 3:11128808-11128830 CAATATCACACCAAGGATATTGG - Intergenic
951301673 3:21005731-21005753 AAAAAACCCAACATATATATTGG + Intergenic
951376889 3:21929094-21929116 CAATCCAACAACATATAAATAGG + Intronic
952545011 3:34409529-34409551 CAATATCACAACCTGTCTGTCGG + Intergenic
952641876 3:35606434-35606456 CATTATCAAAAAATATCTATTGG + Intergenic
952682744 3:36113849-36113871 TAATATCTCATCATATTTATAGG + Intergenic
953544194 3:43850927-43850949 TAATATCACAAAAGATATATGGG - Intergenic
953591351 3:44258339-44258361 CAATATCACAACCAGAATATTGG + Intronic
953757690 3:45661436-45661458 TAATATTCCAACATGTATATGGG + Intronic
955133829 3:56196326-56196348 CAAGATCACAAAAGATATAGTGG - Intronic
956330809 3:68105271-68105293 CAGTATCAAAACAAAAATATTGG + Intronic
957664486 3:83206924-83206946 AAATTTTACAACATATAAATAGG - Intergenic
957861293 3:85954780-85954802 AAATATGATAACATAAATATTGG + Intronic
957922653 3:86765841-86765863 AAAAATCTCAACATATATGTTGG + Intergenic
959119062 3:102211548-102211570 CACTATCACTAGAAATATATAGG + Intronic
959437623 3:106336172-106336194 TAATTTCACAACACATTTATTGG - Intergenic
959588135 3:108045453-108045475 CAAAATAATAACATATATAGAGG - Intronic
960374742 3:116885507-116885529 CAATTTCACAACAAATATAAAGG + Intronic
960777189 3:121270080-121270102 CAATATCACAACATATCCAAAGG - Intronic
960830149 3:121837489-121837511 CAAAGTCACATTATATATATAGG - Intronic
963017872 3:140842849-140842871 CAAAATCATAATTTATATATTGG - Intergenic
963751990 3:149190241-149190263 GAATATAACCACATATATAGGGG + Intronic
964169103 3:153746164-153746186 AAAGATCACAACATAAATGTAGG + Intergenic
964199627 3:154104125-154104147 CAATATCATATCACTTATATTGG - Intergenic
965175450 3:165324636-165324658 CAATCTCAGAGCATAAATATGGG + Intergenic
967917543 3:194589859-194589881 CAATACCACAGCATACACATGGG - Intronic
968409451 4:375350-375372 CAACATCAGAAAATTTATATTGG + Intronic
969897038 4:10315084-10315106 CCAGATCACCACATATATATAGG + Intergenic
973744793 4:53952876-53952898 AAATATCACTATATATTTATCGG - Intronic
974248391 4:59353050-59353072 AAAAATCAAAACATGTATATGGG - Intergenic
974728820 4:65834581-65834603 CAATAACACAACATATAGGAGGG - Intergenic
975949377 4:79749499-79749521 CAATATAAAAAGATATAAATTGG + Intergenic
976341410 4:83949687-83949709 CAATATAATAACATTTATTTGGG - Intergenic
976540952 4:86275234-86275256 CATTATCTCAACATCTATTTAGG + Intronic
976724443 4:88202072-88202094 CAAGATCACAAAATGAATATCGG + Intronic
977031053 4:91883445-91883467 CAATACCACAACATAAATTGTGG - Intergenic
977364536 4:96051063-96051085 TGAAATCACAAAATATATATTGG - Intergenic
978754807 4:112290674-112290696 TGATATTACAACATATTTATAGG - Intronic
979263472 4:118674401-118674423 CAATATCACAACCAAGATACTGG - Intergenic
979364994 4:119811177-119811199 CAATATTTCATCATATATTTAGG + Intergenic
980586189 4:134818373-134818395 AAATAACACAATATAGATATCGG - Intergenic
980845538 4:138319768-138319790 CATTATCTCAACATCTATCTTGG - Intergenic
981414447 4:144474564-144474586 CAATATCACACCATCTTGATTGG - Intergenic
982450743 4:155549611-155549633 TAATATTTCAACATATAAATTGG + Intergenic
983756675 4:171347146-171347168 CAATAACATAACATATTCATAGG + Intergenic
986660391 5:10054362-10054384 TATTATCATAACATATATTTGGG - Intergenic
987355496 5:17060146-17060168 AAATATCAAAAAATATATATTGG + Intergenic
987700937 5:21397380-21397402 CAAAATCAGAAAATTTATATTGG - Intergenic
987804274 5:22742661-22742683 AAATATCAATACATATATTTAGG + Intronic
992167359 5:74067788-74067810 AAATTTCACAACATCAATATCGG - Intergenic
992915366 5:81445487-81445509 CCATATAAGAACATAAATATGGG + Intronic
993208196 5:84912786-84912808 AAATATAACAATATATATATAGG + Intergenic
994435125 5:99719467-99719489 CAAAATGACAACTTAAATATAGG + Intergenic
994711586 5:103271420-103271442 CCAAATCACAACACATGTATAGG - Intronic
995378692 5:111508218-111508240 CAATATAATAACTTATTTATAGG + Intronic
995931010 5:117444150-117444172 CAAAATAACAACATATATTTTGG - Intergenic
997756242 5:136402032-136402054 CAAGATGAAAACATAAATATGGG + Intergenic
998074865 5:139227526-139227548 CAATATCAAAACATTTAAAAGGG + Intronic
998547507 5:143043095-143043117 TAATATCACAACCAAAATATTGG + Intronic
998680115 5:144457693-144457715 CAATATCACAACATATATATTGG - Intronic
999682756 5:154075253-154075275 AATCATCACAACAAATATATGGG + Intronic
1000532266 5:162438021-162438043 GATTATCACAACAGATATAATGG - Intergenic
1000816524 5:165929415-165929437 CAATATCAGAAAGTATAGATTGG + Intergenic
1001570563 5:172727833-172727855 CAATCTCACAACAAACCTATGGG + Intergenic
1004963120 6:20814937-20814959 CCAGATCTCAACATATAGATGGG - Intronic
1008295446 6:49770266-49770288 CAATTTCACCCCATATATACAGG - Intergenic
1008410085 6:51167336-51167358 TTATATAACTACATATATATGGG - Intergenic
1008633084 6:53382515-53382537 GAATATTACAAAATATTTATAGG - Intergenic
1008643271 6:53486497-53486519 CAGTATCACAACCAAGATATTGG + Intergenic
1010891019 6:81310635-81310657 CTATCTCAAAAAATATATATAGG + Intergenic
1011690482 6:89862752-89862774 AAAGATCACAAAATATAAATAGG + Exonic
1011875160 6:91950357-91950379 CAATGTCACAATATAATTATAGG - Intergenic
1012569865 6:100710700-100710722 CTATATTACAACATATGTTTGGG + Intronic
1013080095 6:106804955-106804977 CAATAACACACAATAAATATTGG + Intergenic
1013718839 6:112998555-112998577 AAATATCAAAACATTTTTATTGG - Intergenic
1014318903 6:119901137-119901159 CAATATCTCTGCATATATTTAGG - Intergenic
1016515402 6:144888038-144888060 AAATCTCATAACATATACATAGG - Intergenic
1016667038 6:146654337-146654359 TAATACCAAAAAATATATATGGG + Intronic
1018213327 6:161503398-161503420 CATTCTCACCACAAATATATGGG + Intronic
1020598647 7:10244840-10244862 CAATATCTTAAAATATATGTAGG + Intergenic
1020825984 7:13029064-13029086 CATAATCACTACATATTTATGGG + Intergenic
1020908889 7:14103091-14103113 CTATATGTCTACATATATATGGG - Intergenic
1022163353 7:27733511-27733533 AAATATCACATCATATAGGTTGG + Intergenic
1022302524 7:29114629-29114651 CAAAAAAAAAACATATATATAGG + Intronic
1022670704 7:32452759-32452781 CTATATCATAATATGTATATAGG - Intergenic
1023106739 7:36770417-36770439 ATATATCACAACATAAATATAGG + Intergenic
1023747847 7:43338940-43338962 TAATTTCACAATATATATAGCGG + Intronic
1025527265 7:61830670-61830692 CAATATCTCAAGATATAAACTGG - Intergenic
1028426433 7:90695211-90695233 AAATATTACAACATATTTAAAGG - Intronic
1028602829 7:92620991-92621013 GAATTTCACAACACATATTTGGG - Intronic
1030001567 7:105069727-105069749 CAATATCACAACTAGGATATTGG + Intronic
1031227724 7:119061793-119061815 CAATAGAACAAAATGTATATGGG + Intergenic
1031652692 7:124310548-124310570 CAATATCACAATTAATATTTTGG + Intergenic
1032272526 7:130423282-130423304 AAATAACCCAACATAAATATGGG + Intronic
1034034770 7:147807460-147807482 TAATATTTGAACATATATATGGG - Intronic
1034599028 7:152230401-152230423 CATAATCAAAACATATATTTTGG + Intronic
1040516610 8:48140795-48140817 GAATTTCACCAAATATATATTGG - Intergenic
1040776975 8:51057235-51057257 TAATCTAACAACACATATATGGG - Intergenic
1042068655 8:64906362-64906384 CAATATCAGAACACAGATGTGGG - Intergenic
1042301347 8:67285701-67285723 TAATACCACATCATATAAATTGG - Intronic
1043151448 8:76721751-76721773 CAATGTGACAACATCTTTATTGG - Intronic
1043762649 8:84087743-84087765 CAATATCAGCAGATATATTTAGG - Intergenic
1044213096 8:89573755-89573777 CAATATCACAACCAAGATATTGG + Intergenic
1044855571 8:96471791-96471813 GAATATCAGAACATACATAGTGG + Intergenic
1045804535 8:106142643-106142665 CAATATTAAAACATAAATTTGGG + Intergenic
1045964864 8:108013487-108013509 CATTATCAAAACAGATATATAGG + Intronic
1046011113 8:108548731-108548753 GAATATCACATCATCTAAATGGG + Intergenic
1046040346 8:108896130-108896152 GAATAACAAAACATAAATATAGG + Intergenic
1046301281 8:112294623-112294645 CAAATCCACAACATACATATAGG + Intronic
1047061991 8:121237434-121237456 CAATATCACAACTTTTAAAAGGG + Intergenic
1048691266 8:136966890-136966912 CAATATCTCAGCATATTTATTGG - Intergenic
1050628409 9:7533106-7533128 CAATATCAAATCATTTTTATTGG - Intergenic
1050710760 9:8460378-8460400 CAAAATTACAACAGAAATATTGG + Intronic
1051806009 9:20993157-20993179 GAAAATCACCTCATATATATAGG + Intronic
1052101683 9:24454416-24454438 CAATATCACAAGAACAATATAGG - Intergenic
1052778534 9:32756902-32756924 AAGTTTCACAACATATATGTGGG - Intergenic
1055234071 9:74098455-74098477 CAATTTCAGAAAATTTATATTGG + Intergenic
1055273548 9:74588539-74588561 TAATATTACACCATATATATTGG - Intronic
1055984556 9:82043743-82043765 ATATATCACAATATATAAATGGG + Intergenic
1056148288 9:83757412-83757434 AAATTTCACAAAATATAAATAGG + Intronic
1056378943 9:86040135-86040157 CAATTTCAGAACATTTTTATTGG - Intronic
1056589743 9:87957135-87957157 AAATAAGATAACATATATATAGG + Intergenic
1056686713 9:88770493-88770515 AAATATAACAAAATATATATAGG - Intergenic
1058568053 9:106308254-106308276 CTATACCAAAACATATGTATTGG - Intergenic
1059096999 9:111427852-111427874 AATTATCAGAAAATATATATAGG - Intronic
1060140411 9:121204806-121204828 CCATATCAGGACATATACATGGG - Intronic
1186387601 X:9125799-9125821 AAATAACACAAAATACATATAGG - Intronic
1186600167 X:11028319-11028341 AAAAATCAAAAAATATATATTGG - Intergenic
1188177335 X:27007310-27007332 TAATATCTGTACATATATATGGG - Intergenic
1188349471 X:29110257-29110279 AAAAATCAGAACATACATATAGG - Intronic
1188591123 X:31836528-31836550 TAAGATCACAATATATAAATAGG + Intronic
1189140518 X:38600597-38600619 CAATTTGACAACCTATAAATAGG + Intronic
1190219551 X:48502544-48502566 CAATATCACTTCCTATACATAGG - Intergenic
1193359413 X:80562507-80562529 AAATATTACAAAATATTTATAGG - Intergenic
1194176266 X:90651807-90651829 CAATTGCACAAAATATATATTGG + Intergenic
1194431058 X:93805992-93806014 AAATATAAGAACATATACATAGG - Intergenic
1195162836 X:102187532-102187554 TGATATCAAAACAGATATATAGG - Intergenic
1196304097 X:114080567-114080589 GAATATCACAAAATCAATATTGG + Intergenic
1199052560 X:143253831-143253853 AAATATGGTAACATATATATTGG - Intergenic
1199170397 X:144728244-144728266 CAATATAAAATCATATATAATGG + Intergenic
1200522891 Y:4232752-4232774 CAGTTGCACAAAATATATATTGG + Intergenic
1201172491 Y:11282392-11282414 GAATATGACAAAATATATTTTGG - Intergenic
1201626997 Y:16025665-16025687 CACTATCACAAGAAAAATATGGG + Intergenic