ID: 998682618

View in Genome Browser
Species Human (GRCh38)
Location 5:144487200-144487222
Sequence ATGTCATTCTGGAACAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998682618_998682622 14 Left 998682618 5:144487200-144487222 CCTCCACTGTTCCAGAATGACAT No data
Right 998682622 5:144487237-144487259 CCAACATTAAGAGAAAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998682618 Original CRISPR ATGTCATTCTGGAACAGTGG AGG (reversed) Intergenic
No off target data available for this crispr