ID: 998685581

View in Genome Browser
Species Human (GRCh38)
Location 5:144520618-144520640
Sequence AATTATATGCAGAAATTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998685581_998685584 29 Left 998685581 5:144520618-144520640 CCTAGGAATTTCTGCATATAATT No data
Right 998685584 5:144520670-144520692 TGCCTTTGAGCTGCCACTCTGGG No data
998685581_998685583 28 Left 998685581 5:144520618-144520640 CCTAGGAATTTCTGCATATAATT No data
Right 998685583 5:144520669-144520691 ATGCCTTTGAGCTGCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998685581 Original CRISPR AATTATATGCAGAAATTCCT AGG (reversed) Intergenic
No off target data available for this crispr