ID: 998687379

View in Genome Browser
Species Human (GRCh38)
Location 5:144543905-144543927
Sequence AACTCCTTGTGGAAATCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998687374_998687379 30 Left 998687374 5:144543852-144543874 CCAGTAGTGGGCCAGCAGCCTTT No data
Right 998687379 5:144543905-144543927 AACTCCTTGTGGAAATCAGAAGG No data
998687375_998687379 19 Left 998687375 5:144543863-144543885 CCAGCAGCCTTTTTGAGTCATAA No data
Right 998687379 5:144543905-144543927 AACTCCTTGTGGAAATCAGAAGG No data
998687377_998687379 -8 Left 998687377 5:144543890-144543912 CCATTCTTCAATCACAACTCCTT No data
Right 998687379 5:144543905-144543927 AACTCCTTGTGGAAATCAGAAGG No data
998687376_998687379 12 Left 998687376 5:144543870-144543892 CCTTTTTGAGTCATAAATAACCA No data
Right 998687379 5:144543905-144543927 AACTCCTTGTGGAAATCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998687379 Original CRISPR AACTCCTTGTGGAAATCAGA AGG Intergenic
No off target data available for this crispr