ID: 998692238

View in Genome Browser
Species Human (GRCh38)
Location 5:144599411-144599433
Sequence TTTTTTTTACAGATGGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998692236_998692238 -1 Left 998692236 5:144599389-144599411 CCATTTTTTTTTTTTTTTTTTTT 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626
Right 998692238 5:144599411-144599433 TTTTTTTTACAGATGGAGTCTGG No data
998692235_998692238 8 Left 998692235 5:144599380-144599402 CCATATTCTCCATTTTTTTTTTT No data
Right 998692238 5:144599411-144599433 TTTTTTTTACAGATGGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998692238 Original CRISPR TTTTTTTTACAGATGGAGTC TGG Intergenic
No off target data available for this crispr