ID: 998693027

View in Genome Browser
Species Human (GRCh38)
Location 5:144608617-144608639
Sequence CAATGTGTGTGAAGGCGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998693027_998693030 23 Left 998693027 5:144608617-144608639 CCTTCTCGCCTTCACACACATTG No data
Right 998693030 5:144608663-144608685 AACCAAAGCATACTTAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998693027 Original CRISPR CAATGTGTGTGAAGGCGAGA AGG (reversed) Intergenic
No off target data available for this crispr