ID: 998694472

View in Genome Browser
Species Human (GRCh38)
Location 5:144623738-144623760
Sequence CAGTGTAATATTAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998694466_998694472 16 Left 998694466 5:144623699-144623721 CCTACTCAAAACTCCTAAAGTTA No data
Right 998694472 5:144623738-144623760 CAGTGTAATATTAAGGAGAAAGG No data
998694468_998694472 3 Left 998694468 5:144623712-144623734 CCTAAAGTTACCCAGGCTTGTAT No data
Right 998694472 5:144623738-144623760 CAGTGTAATATTAAGGAGAAAGG No data
998694470_998694472 -8 Left 998694470 5:144623723-144623745 CCAGGCTTGTATTTTCAGTGTAA No data
Right 998694472 5:144623738-144623760 CAGTGTAATATTAAGGAGAAAGG No data
998694469_998694472 -7 Left 998694469 5:144623722-144623744 CCCAGGCTTGTATTTTCAGTGTA No data
Right 998694472 5:144623738-144623760 CAGTGTAATATTAAGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998694472 Original CRISPR CAGTGTAATATTAAGGAGAA AGG Intergenic
No off target data available for this crispr