ID: 998708088

View in Genome Browser
Species Human (GRCh38)
Location 5:144787953-144787975
Sequence GTGTTCATGAAGAAAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998708087_998708088 -7 Left 998708087 5:144787937-144787959 CCATAGCAATATTGATGTGTTCA No data
Right 998708088 5:144787953-144787975 GTGTTCATGAAGAAAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998708088 Original CRISPR GTGTTCATGAAGAAAGAAGA TGG Intergenic
No off target data available for this crispr