ID: 998712608

View in Genome Browser
Species Human (GRCh38)
Location 5:144843863-144843885
Sequence TCCAAACAGCAAACTATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998712608_998712610 -1 Left 998712608 5:144843863-144843885 CCTGCTATAGTTTGCTGTTTGGA No data
Right 998712610 5:144843885-144843907 ATCCATGCATTCTTCCCACTGGG No data
998712608_998712609 -2 Left 998712608 5:144843863-144843885 CCTGCTATAGTTTGCTGTTTGGA No data
Right 998712609 5:144843884-144843906 GATCCATGCATTCTTCCCACTGG No data
998712608_998712611 0 Left 998712608 5:144843863-144843885 CCTGCTATAGTTTGCTGTTTGGA No data
Right 998712611 5:144843886-144843908 TCCATGCATTCTTCCCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998712608 Original CRISPR TCCAAACAGCAAACTATAGC AGG (reversed) Intergenic
No off target data available for this crispr