ID: 998712609

View in Genome Browser
Species Human (GRCh38)
Location 5:144843884-144843906
Sequence GATCCATGCATTCTTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998712608_998712609 -2 Left 998712608 5:144843863-144843885 CCTGCTATAGTTTGCTGTTTGGA No data
Right 998712609 5:144843884-144843906 GATCCATGCATTCTTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998712609 Original CRISPR GATCCATGCATTCTTCCCAC TGG Intergenic
No off target data available for this crispr