ID: 998715241

View in Genome Browser
Species Human (GRCh38)
Location 5:144876118-144876140
Sequence TAGACACAGCTGCTAAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998715241_998715243 17 Left 998715241 5:144876118-144876140 CCTTCTTTTAGCAGCTGTGTCTA No data
Right 998715243 5:144876158-144876180 GTAAAAATAACAACCTAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998715241 Original CRISPR TAGACACAGCTGCTAAAAGA AGG (reversed) Intergenic
No off target data available for this crispr