ID: 998717685

View in Genome Browser
Species Human (GRCh38)
Location 5:144904663-144904685
Sequence CTGGAAAAACTGCTTGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998717680_998717685 16 Left 998717680 5:144904624-144904646 CCAAAATGAATTACAATATTTAA No data
Right 998717685 5:144904663-144904685 CTGGAAAAACTGCTTGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998717685 Original CRISPR CTGGAAAAACTGCTTGAACA TGG Intergenic
No off target data available for this crispr