ID: 998729923

View in Genome Browser
Species Human (GRCh38)
Location 5:145062923-145062945
Sequence CTGTGTGTGGGGAGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998729915_998729923 30 Left 998729915 5:145062870-145062892 CCTAGGAAACAAGACTAAGAGAA No data
Right 998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998729923 Original CRISPR CTGTGTGTGGGGAGGGCAGT GGG Intergenic
No off target data available for this crispr