ID: 998734808

View in Genome Browser
Species Human (GRCh38)
Location 5:145124891-145124913
Sequence TGACCCGTCATTCCTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998734808_998734814 19 Left 998734808 5:145124891-145124913 CCAGCCCCAGGAATGACGGGTCA No data
Right 998734814 5:145124933-145124955 TCTTCATCAGTGTTCTTCAACGG No data
998734808_998734815 20 Left 998734808 5:145124891-145124913 CCAGCCCCAGGAATGACGGGTCA No data
Right 998734815 5:145124934-145124956 CTTCATCAGTGTTCTTCAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998734808 Original CRISPR TGACCCGTCATTCCTGGGGC TGG (reversed) Intergenic
No off target data available for this crispr