ID: 998740892

View in Genome Browser
Species Human (GRCh38)
Location 5:145199996-145200018
Sequence GGGAAGATTAATGAAAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998740892_998740893 -9 Left 998740892 5:145199996-145200018 CCTCATTTTTCATTAATCTTCCC No data
Right 998740893 5:145200010-145200032 AATCTTCCCCACATTTGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998740892 Original CRISPR GGGAAGATTAATGAAAAATG AGG (reversed) Intergenic
No off target data available for this crispr