ID: 998743294

View in Genome Browser
Species Human (GRCh38)
Location 5:145229154-145229176
Sequence GTCCCACAGCCCCACAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 271}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998743291_998743294 5 Left 998743291 5:145229126-145229148 CCGTCCAGCGGGTGGGGGCCAAG 0: 1
1: 0
2: 5
3: 37
4: 410
Right 998743294 5:145229154-145229176 GTCCCACAGCCCCACAAGAAAGG 0: 1
1: 0
2: 3
3: 23
4: 271
998743283_998743294 23 Left 998743283 5:145229108-145229130 CCCACAAAAAAGTGGAAACCGTC 0: 1
1: 0
2: 0
3: 9
4: 97
Right 998743294 5:145229154-145229176 GTCCCACAGCCCCACAAGAAAGG 0: 1
1: 0
2: 3
3: 23
4: 271
998743284_998743294 22 Left 998743284 5:145229109-145229131 CCACAAAAAAGTGGAAACCGTCC 0: 1
1: 0
2: 0
3: 10
4: 95
Right 998743294 5:145229154-145229176 GTCCCACAGCCCCACAAGAAAGG 0: 1
1: 0
2: 3
3: 23
4: 271
998743292_998743294 1 Left 998743292 5:145229130-145229152 CCAGCGGGTGGGGGCCAAGTGTG 0: 1
1: 0
2: 4
3: 12
4: 163
Right 998743294 5:145229154-145229176 GTCCCACAGCCCCACAAGAAAGG 0: 1
1: 0
2: 3
3: 23
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998743294 Original CRISPR GTCCCACAGCCCCACAAGAA AGG Intergenic
900400214 1:2469955-2469977 GTTCCACAGTCCCACCAGAGTGG - Intronic
900418306 1:2545067-2545089 TTCCCACAGCCCCACAGAAAGGG + Intergenic
901882057 1:12199699-12199721 GTGCCACCGCCCCCCAAGAAAGG - Intronic
903230356 1:21918587-21918609 TCCCAACAGCCCCACAAGATCGG + Intronic
903478511 1:23636792-23636814 TTCCAACAACCCCAGAAGAAGGG + Intronic
903576225 1:24341296-24341318 ACCCCACAGCCACACAAGATAGG + Intronic
904160485 1:28518866-28518888 GTCCCCCAGCCCCGCAAGAGAGG - Intronic
909389001 1:75096056-75096078 GTCCCAAAGCCTCAAAAGTAGGG - Intergenic
911356493 1:96827346-96827368 GTTCCACAGGCCCACTAAAAAGG - Intergenic
915446256 1:155976556-155976578 GTCCCAGCTCCCCACAATAATGG + Intronic
916123431 1:161549336-161549358 AACCCATATCCCCACAAGAAAGG + Intronic
916133323 1:161630694-161630716 AACCCATATCCCCACAAGAAAGG + Intronic
919280202 1:195481313-195481335 GTCCCACAGCCACAGAAGTTTGG + Intergenic
920019471 1:202943795-202943817 GTCCCACTGCGCCACAATGATGG + Exonic
920697125 1:208189436-208189458 GTCCAGCAGGCCCACCAGAAGGG + Intronic
921443663 1:215219183-215219205 GTTTTACAGCCACACAAGAATGG - Intronic
922225773 1:223645035-223645057 GTCCCAAAACCCCAAAAGCAGGG + Intronic
923776331 1:236981897-236981919 GTCCCCCATCCCCAGAAAAAAGG + Intergenic
1063827114 10:9910603-9910625 GTCCCAAATCCTCAAAAGAAGGG + Intergenic
1064177858 10:13090899-13090921 GTCCCAAAGCCTCAAAAGTAGGG + Intronic
1065154336 10:22854012-22854034 ATCCCACATCATCACAAGAAGGG - Intergenic
1066109383 10:32182717-32182739 GCCCGACAGCCCCACAGGACTGG + Intergenic
1066401319 10:35079251-35079273 GTCTCACACCTTCACAAGAAGGG - Intronic
1067771233 10:49127712-49127734 CTCCCCCAACCCCACAACAAAGG - Intergenic
1068238068 10:54264092-54264114 GTCCCAAAGCCTCAAAAGTAGGG - Intronic
1068674568 10:59757521-59757543 GTCTCAGAGCCCCACGGGAAAGG + Intergenic
1069108309 10:64410865-64410887 GTCCCAAAGCCTCAAAAGTAGGG + Intergenic
1070676373 10:78414456-78414478 GTTCAACACCACCACAAGAAGGG - Intergenic
1071308863 10:84324844-84324866 GTCCCAAAGCCTCAAAAGTAGGG - Intergenic
1071429042 10:85591441-85591463 GTACCACATTCCCACTAGAATGG + Intergenic
1074531179 10:114299974-114299996 GTCCCAAAGCCTCAAAAGTAGGG - Intronic
1074878031 10:117629785-117629807 GTCCCAAAACCTCACAAGTAGGG + Intergenic
1075954750 10:126513315-126513337 TTCCCATAGCCCCACAAGACAGG - Intronic
1076313168 10:129522384-129522406 GTCACACACCCACACAGGAAAGG - Intronic
1076754761 10:132563373-132563395 GACCCACATCCCCACAGAAAAGG - Intronic
1077422759 11:2460690-2460712 GCCCCACTGCCCCACAAGAGCGG - Intronic
1077800035 11:5528025-5528047 GACCACCAGCCCCACTAGAAGGG + Intronic
1078335046 11:10456493-10456515 GTGCCACAGTCCCTCCAGAAAGG - Intronic
1078801296 11:14645927-14645949 GTCTCAGATCCTCACAAGAACGG + Intronic
1079237989 11:18703119-18703141 GCCACACAGGCCCACAAGCAGGG - Exonic
1083529947 11:63411039-63411061 GTCCCAAAACCCCAAAAGTAGGG + Intergenic
1084376968 11:68784249-68784271 TGCCCACAGCCCCGTAAGAAAGG + Intronic
1085121513 11:73970324-73970346 TTCCCTGTGCCCCACAAGAAGGG - Intronic
1085699648 11:78734730-78734752 GTTCCACTGCCCCACACGCATGG + Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1088568058 11:111194474-111194496 AACCCACAGCCCAACAAAAAGGG + Intergenic
1090196933 11:124824610-124824632 GTCCCAAAGCCTCAAAAGTAGGG + Intergenic
1090442154 11:126733329-126733351 ATCCCTCAGACCCACAAGAGAGG + Intronic
1090741677 11:129667567-129667589 GTACTACAGACCCACCAGAATGG + Intergenic
1091938006 12:4448815-4448837 GTCCCTAAGCCCCAAGAGAAGGG - Intergenic
1091971887 12:4794281-4794303 GCCCCACATCCCCACAAGACAGG - Intronic
1096113797 12:49043494-49043516 GTCCCACAGCCCTACAGGCCAGG + Intronic
1096494091 12:52029323-52029345 GACCCACAGGCACACAAGGAGGG - Intronic
1098787756 12:74781226-74781248 GTCCCAAAACCCCAAAAGTAGGG - Intergenic
1099113305 12:78590241-78590263 GTCTCACAGCTCCATGAGAATGG + Intergenic
1099400002 12:82192454-82192476 GTCCCAAAGCCTCAAAAGTAGGG - Intergenic
1101709467 12:107251424-107251446 GTCCCAAAGCCTCAAAAGTAGGG + Intergenic
1102313460 12:111865926-111865948 GACCCACAGCCCCAAAAGCATGG + Intronic
1104055232 12:125225008-125225030 ATCCCACACCTCCACCAGAAAGG - Intronic
1104073710 12:125370978-125371000 GTCCCAAAGCCTCAAAAGTAGGG + Intronic
1104736046 12:131136565-131136587 GACCCACAGGCCCCCAAGGAAGG + Intronic
1107087157 13:36437710-36437732 GTCCAAGAGCCCCCCAAGCAAGG + Exonic
1108466499 13:50721295-50721317 GTCCCAAAACCCCAAAAGTAGGG - Intronic
1109004071 13:56846501-56846523 GTCATACAGCCCCAGAATAAAGG - Intergenic
1109171086 13:59097695-59097717 GTCCCAAAACCCCAAAAGTAGGG - Intergenic
1109886101 13:68547358-68547380 GTCCCAGAACCTCACAAGTAGGG + Intergenic
1111525014 13:89456913-89456935 GTCCCAAAACCTCAAAAGAAGGG - Intergenic
1112358962 13:98699207-98699229 GTCCCACTCCCCCAAAAGAGTGG - Intronic
1112561111 13:100514974-100514996 TTCCCACAGCCCTCCAAGAGCGG - Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113671561 13:112178968-112178990 GCCCCACAGCCTCACAGGGAGGG - Intergenic
1114671005 14:24411059-24411081 GTCCCACGACCCCACAGGCATGG + Exonic
1116388150 14:44358463-44358485 GTCCCAAAGCCTCAAAAGCAGGG + Intergenic
1117535401 14:56698133-56698155 GTCCCAAAACCTCACAAGTATGG + Intronic
1117797377 14:59408466-59408488 GTCCCACACCCCCAGACCAAGGG + Intergenic
1117808632 14:59521369-59521391 GTCCCAAAGCCTCACAAGTAGGG - Intronic
1119180846 14:72604419-72604441 GTCCCATAGGCACACAGGAAGGG - Intergenic
1119228161 14:72959925-72959947 CACCCACAGCCCAACCAGAAGGG - Intergenic
1119758699 14:77136555-77136577 GTCCCACAAAGCCAAAAGAAAGG + Intronic
1120100923 14:80444998-80445020 GTCCCAGAACCTCACAAGTAGGG + Intergenic
1121561844 14:94881789-94881811 CTCCCACAGCCCCATGAGAGGGG + Intergenic
1122280907 14:100621992-100622014 CCCCCACAGCCCCACATGATTGG + Intergenic
1123043421 14:105499768-105499790 GTCCGACAGCCCCAGAAGAGAGG - Intergenic
1124254730 15:28131367-28131389 ACCCCACAGCCCCACGAGAGAGG + Intronic
1124364574 15:29062884-29062906 TCCCCACAGCCCCACGAGATGGG - Intronic
1124788053 15:32700163-32700185 GTCCCACAGGAACACAAAAAGGG - Intergenic
1125536227 15:40442123-40442145 GGCCCCCAGCCCCAGAAGAGAGG - Intronic
1127704364 15:61532598-61532620 GTCCCCCTGCCCCCCAAAAAAGG - Intergenic
1127706088 15:61548525-61548547 GTCCCACTGCCCCAGAACACTGG + Intergenic
1128108485 15:65061379-65061401 GTTCCACATCCCCACCAGACTGG - Intronic
1128376440 15:67079788-67079810 ACCCCATAGCCCCTCAAGAAAGG + Intronic
1128495615 15:68196810-68196832 GTTCCAGAGCCCCACGAGAAAGG - Intronic
1129232101 15:74202698-74202720 GACCCACAGACACACCAGAAGGG + Exonic
1129301104 15:74626066-74626088 GTCCCTCAGGCCCAGGAGAATGG - Intronic
1129420951 15:75426260-75426282 CTGCCCCAGCCCCACAGGAAGGG + Intronic
1132303941 15:100795021-100795043 GTCCCAAAGCCTCAGAAGTAGGG + Intergenic
1132532822 16:461891-461913 GTCCCCCAGCCCCTCTTGAATGG + Intronic
1134020455 16:10917890-10917912 GTCCCACAGTCCTACAATTAAGG - Intronic
1134510580 16:14843546-14843568 ATACCACACCCCCACCAGAAGGG - Intronic
1134698218 16:16242035-16242057 ATACCACACCCCCACCAGAAGGG - Intronic
1134973619 16:18552642-18552664 ATACCACACCCCCACCAGAAGGG + Intronic
1135471883 16:22738419-22738441 GTCCAAGAGCCCCAGAACAAGGG - Intergenic
1135897245 16:26418849-26418871 GTCCCACCCCCCCGCAAAAAGGG + Intergenic
1135908138 16:26532786-26532808 GTCCCACAGAGCCACTAGACAGG - Intergenic
1137687649 16:50397798-50397820 GTCCCAAAACCTCAAAAGAAGGG + Intergenic
1138033924 16:53583273-53583295 GTCCCAAAACCCCAAAAGTAGGG - Intergenic
1140897319 16:79335974-79335996 GTCCCACATCCCCAGAAGCTGGG - Intergenic
1141219071 16:82052187-82052209 TTCCCACAGCCCACCAAGGAAGG - Intronic
1143772778 17:9179102-9179124 CTCCCAGAGCCTCACAGGAAGGG - Intronic
1144080955 17:11763374-11763396 GTCCAACAGCACCACCAGAATGG + Intronic
1144122167 17:12165704-12165726 TTCCCACAGCTCCACTAGTATGG + Intergenic
1144745502 17:17611471-17611493 GTCCCCCAGCCCGACAGCAAGGG - Intergenic
1144837317 17:18163436-18163458 CTCCCACAGCCCCACAAGGCAGG + Intronic
1145250933 17:21296671-21296693 CTCCCACAGCCCTACAGGGAGGG - Intronic
1147325118 17:39666339-39666361 GACCCTCAGCCCCAGGAGAAGGG + Exonic
1149470514 17:56912327-56912349 GTCCCACAGCCTCACTATACTGG + Intronic
1151069030 17:71187150-71187172 GTCCCAAAACCCCAAAAGTAGGG + Intergenic
1152184367 17:78844794-78844816 GTGCCACAGGGCCACAGGAAGGG - Intergenic
1152302519 17:79503671-79503693 GTCCTGCAGCCCCACAACCAAGG + Intronic
1154130604 18:11733992-11734014 GGCCCCCAGCCTCACCAGAAGGG + Intronic
1156466847 18:37353261-37353283 GTCCCTAAGCCCCCCAAGAAAGG - Intronic
1157064509 18:44331851-44331873 GTCCCACAGCCTCAAAATTAGGG - Intergenic
1157967264 18:52222360-52222382 TTTCCAGAGCCCCACAGGAATGG - Intergenic
1158568845 18:58579492-58579514 GTCCCTCATCCCCACAAACAGGG - Exonic
1160979538 19:1810670-1810692 CTCCCACAGCCCCACCAGCATGG - Exonic
1161390572 19:4018433-4018455 ATCCGAGAGCCCAACAAGAAGGG - Intronic
1162095931 19:8309938-8309960 ATCCCACAGCCCCAGCATAATGG + Intronic
1162096143 19:8311082-8311104 ATCCCACAGCCCCAGCATAATGG + Intronic
1163256608 19:16159792-16159814 GTCACACAGCCCCACAACCTAGG - Intergenic
1166170188 19:41022868-41022890 GTCAAACAGCCCCACATGAGAGG - Intergenic
1166334066 19:42095020-42095042 GTGCCATAGCCACACAGGAAGGG - Intronic
1166477191 19:43137611-43137633 GTCCCAAAGCCTCAAAAGTAAGG - Intronic
1167878158 19:52431332-52431354 GTGCCACAGCCACACAAAAAGGG - Intronic
925303573 2:2834046-2834068 GTCCCAAAGCCACACATGATAGG + Intergenic
925417157 2:3678373-3678395 GTCCCACAGTGCCAGAGGAACGG - Intronic
926388571 2:12363251-12363273 GTCCCAAAGCCTCAAAAGTAGGG - Intergenic
926647248 2:15303032-15303054 GTCCCAAAACCTCAAAAGAAGGG - Intronic
927292688 2:21420202-21420224 ATCGCCCAGCCCAACAAGAATGG - Intergenic
927464634 2:23327989-23328011 GCCCCACAGTCACAGAAGAATGG - Intergenic
927873589 2:26639940-26639962 CCCCCACAGCCCCACGAGAAGGG + Intronic
927908740 2:26881279-26881301 GTATCACTGCCCCAGAAGAAGGG + Intronic
928493843 2:31811830-31811852 ATGCCACAGCCCCACAGGAGAGG - Intergenic
928621213 2:33089914-33089936 TTACAACAGCCACACAAGAATGG + Intronic
928826262 2:35425221-35425243 GTCCCAAAGCCTCAAAAGTAGGG + Intergenic
929000595 2:37344328-37344350 TTCCCACAGCTCCTAAAGAAGGG - Intergenic
929136276 2:38626779-38626801 GTCCCAAAGCCTCAAAAGTAGGG + Intergenic
929919197 2:46160620-46160642 GTTCCACAGCCCCACAGCACTGG - Intronic
930118053 2:47736817-47736839 GTCCCACACCACCACACTAAAGG + Intronic
930214973 2:48685884-48685906 GACCCCCAGCCCCACAGGGAAGG - Intronic
937103207 2:119287438-119287460 CTCCCACAACCCCACCACAAGGG + Intergenic
941988766 2:171534296-171534318 GTCCCCTAAGCCCACAAGAAGGG - Intronic
943156368 2:184183899-184183921 GTCCCAAAACCTCACAAGTAGGG - Intergenic
944839120 2:203608389-203608411 GTCCCACTTCCCCACCAAAATGG - Intergenic
947153730 2:227139359-227139381 CTCCCACAATCTCACAAGAAAGG - Intronic
947421295 2:229943433-229943455 GTCCCACAGCCCCATTTCAAGGG - Intronic
947488628 2:230575098-230575120 GTCCTGGAGCCCCACACGAATGG + Intergenic
948351434 2:237344296-237344318 TTCTCAGAGCCCCAGAAGAAAGG + Intronic
948572376 2:238925776-238925798 GTCACAAAGACCCACAAGAAAGG - Intergenic
948703788 2:239777250-239777272 CTCCCCCAGCCAGACAAGAAGGG - Intronic
948948633 2:241234830-241234852 GTACCTCAGACCTACAAGAAAGG - Intronic
1170038937 20:12019942-12019964 TTCACACAGCCCCACCAGACAGG + Intergenic
1170142894 20:13142756-13142778 GTCCTACAGCCCCAAAAGACTGG - Intronic
1170808316 20:19653638-19653660 GTCTCACATCCCCCCAGGAACGG - Intronic
1173252264 20:41370226-41370248 GTCCTCCACCCCCACTAGAATGG - Intergenic
1173680248 20:44874291-44874313 GCCCCCTAGCCCCCCAAGAACGG - Intergenic
1174054482 20:47788495-47788517 GGCCCACAGCCCCAGAAGAAGGG - Intergenic
1176191221 20:63811088-63811110 GTCCCAGAACCCCACAGGATGGG + Intronic
1176191264 20:63811214-63811236 GTCCCAGAACCCCACAGGATGGG + Intronic
1177663675 21:24123038-24123060 GTCCCAAAGCCTCAAAAGTAGGG - Intergenic
1178110678 21:29367052-29367074 CTCACTCATCCCCACAAGAATGG - Intronic
1180838644 22:18947283-18947305 GTCCCCCAGCCCGACACCAAGGG + Intergenic
1181140889 22:20804042-20804064 GGCCCCCAGCCTCACAACAACGG + Intronic
1183082087 22:35463141-35463163 GTCCCTGAGCCCCTCAAGCAGGG - Intergenic
1183464652 22:37973530-37973552 GTCCCACAGCCCCACACACTGGG - Exonic
1185292497 22:50034241-50034263 GGCCCACAGCACCACAGGGAAGG - Intronic
949489473 3:4574560-4574582 ATCCCACAGCCCCAAAATACAGG - Intronic
950595381 3:13975944-13975966 GTCCCAGAGCTCCACATGATCGG + Intronic
955492855 3:59500422-59500444 ACCCCACAGGCCCACAGGAATGG + Intergenic
957851895 3:85819016-85819038 GTCCCAAAGCCTCAAAAGTAGGG + Intronic
958902674 3:99906221-99906243 GTACTACAGCCCTACCAGAAAGG - Intronic
959463010 3:106650352-106650374 GTCCCAAAGCCTCAAAAGTAGGG + Intergenic
964867951 3:161282347-161282369 GTCCCAAAGCCTCAAAAGTAAGG + Intergenic
965762784 3:172097362-172097384 GTCCCACAGCCAGAGTAGAATGG + Intronic
968750898 4:2388463-2388485 ATCCCACTGCTGCACAAGAAGGG + Intronic
969146158 4:5125848-5125870 CTCCCACAGACCCCCACGAAGGG + Intronic
969991704 4:11271212-11271234 GTCCCACAACCTCAAAAGTAGGG + Intergenic
971512413 4:27443404-27443426 GTCCCAAAGCCCTAAAAGTAGGG - Intergenic
974153039 4:58034800-58034822 GTACCACACACCTACAAGAATGG + Intergenic
974364358 4:60927041-60927063 TCCCCACAGACCCACAATAAGGG + Intergenic
975315696 4:72950718-72950740 GTCTCACAGCCCCAAAATCAAGG + Intergenic
978298641 4:107239331-107239353 GTCCCAAAACCCCAAAAGTAGGG + Intronic
980763405 4:137266699-137266721 GTCCCAAAACCACAAAAGAAGGG - Intergenic
982370035 4:154624593-154624615 GTCCCAAAGCCTCAAAAGTAGGG + Intergenic
984172965 4:176383165-176383187 TTTCCCCAGCCCGACAAGAAGGG + Intergenic
984899440 4:184571583-184571605 GTCCCACAGCCCTAAAACAGTGG - Intergenic
985795575 5:1959444-1959466 ATCCCAGGGCCTCACAAGAAAGG - Intergenic
986133748 5:4955239-4955261 GTCCCAAAACCTCACAAGTAAGG + Intergenic
989356724 5:40551734-40551756 GTCCCAGAACCTCAAAAGAAGGG - Intergenic
991598601 5:68329873-68329895 GTCCTATAGTCCCACAGGAATGG - Intergenic
992007385 5:72491196-72491218 GGCCCACAGCCCCACAAAAGGGG + Intronic
992127789 5:73659691-73659713 GTTCCACATCACCACAATAAAGG + Intronic
993280642 5:85920880-85920902 AACCCACAGCCCCACCAGACTGG + Intergenic
996399739 5:123048746-123048768 GTCCCAAAACCTCAAAAGAAGGG + Intergenic
997693523 5:135843919-135843941 GTCCCAGAGCCCACCAAGGAGGG + Intronic
998743294 5:145229154-145229176 GTCCCACAGCCCCACAAGAAAGG + Intergenic
999065436 5:148680487-148680509 GTCCCAAAGCCTCAAAAGTAGGG - Intergenic
1001032381 5:168272251-168272273 TTCCCACATTCCCAGAAGAAGGG - Intergenic
1001288425 5:170439798-170439820 CTGCCCCAGGCCCACAAGAAAGG - Intronic
1001299106 5:170520964-170520986 GCCCCACAGCAACCCAAGAAGGG - Intronic
1001315243 5:170637204-170637226 GTCCCACAGGCCCAGAACCACGG + Intronic
1001663923 5:173416825-173416847 TGCCCACAGCCCCACAACCAGGG - Intergenic
1001882767 5:175258948-175258970 CTCCCACAACCCCTCAAAAAAGG - Intergenic
1003506848 6:6746692-6746714 CTCCCACAGAACCACAAAAAGGG - Intergenic
1005047185 6:21653587-21653609 GTCCCAAAGCCTCAAAAGTAGGG - Intergenic
1005071901 6:21869670-21869692 GTCCCAACACCACACAAGAATGG + Intergenic
1006429710 6:33988193-33988215 GCCACACAGCCCAACCAGAATGG - Intergenic
1006448715 6:34093655-34093677 GTCCCACAGCCTCTTAATAAAGG + Intronic
1006727822 6:36212512-36212534 CTGCCACAGCCCCAGAAGTAGGG - Intronic
1006880533 6:37335226-37335248 GTGCCACAGGCCCACAACCATGG + Intergenic
1010181862 6:73096049-73096071 GTCCCAAAACCCCAAAAGTAGGG + Intronic
1010269832 6:73906474-73906496 GTCCCATAGCCACTCAAGGAAGG - Intergenic
1010610811 6:77952154-77952176 TTCTCACAGCTCCACAAGAGGGG - Intergenic
1010925127 6:81735478-81735500 GTACCACAGCCACATAAAAAGGG + Intronic
1011324422 6:86133922-86133944 GTCCCAAAGCCTCAAAAGTAGGG + Intergenic
1012309400 6:97703120-97703142 GTCTCACACCCCCCCAAAAATGG + Intergenic
1014042872 6:116850071-116850093 GTCCCAAAGCCTCAAAAGGAGGG - Intergenic
1015091740 6:129366447-129366469 TTCCCACAGCCCCAAATCAAGGG + Intronic
1015535883 6:134267338-134267360 GTGCCACAGCCCTCCAACAAAGG - Intronic
1016573383 6:145539889-145539911 GGCCCAGAGCCTGACAAGAAAGG - Intronic
1016857867 6:148689189-148689211 GTCCCAAAACCTCAAAAGAAGGG - Intergenic
1018350748 6:162956471-162956493 GTGACACAGTACCACAAGAAAGG + Intronic
1021036176 7:15801817-15801839 GTCCTACAACCACAGAAGAATGG - Intergenic
1022073820 7:26945765-26945787 CTCTCTCTGCCCCACAAGAATGG + Intronic
1022845747 7:34208160-34208182 GTCCCTCAGTCCCACAACACCGG + Intergenic
1024617164 7:51125642-51125664 TTCCCAAATCCCCACAAGATAGG - Intronic
1024709205 7:51996209-51996231 GTGCCCCAGTCCCACAGGAATGG + Intergenic
1026134472 7:67647246-67647268 GTCCCAAAACCTCACAAGCAGGG + Intergenic
1029393355 7:100289856-100289878 GTCCCCCACCCCCCCAAAAAAGG - Intergenic
1030022925 7:105293445-105293467 CTCCCACCCCCCCACAAAAAAGG - Intronic
1030507030 7:110437397-110437419 GTCCCAAAGCCTCAAAAGTAGGG - Intergenic
1032421089 7:131779865-131779887 GCACCACACACCCACAAGAATGG - Intergenic
1033487917 7:141809747-141809769 GTCCCAAAGCCTCAAAAGTAGGG + Intergenic
1033514519 7:142092952-142092974 GTCCATCAGCTCCACAATAAAGG - Intronic
1033903124 7:146167863-146167885 GTCCCAAAGCCTCAAAAGTAGGG + Intronic
1033987808 7:147248031-147248053 CTCCCACTTCCACACAAGAATGG - Intronic
1034358587 7:150474003-150474025 GTCCCACAGGCCCAAGGGAAAGG + Exonic
1035176402 7:157055134-157055156 CTCCCACAGCCCCACCTGCAGGG + Intergenic
1035886590 8:3298038-3298060 GTACCACACCCCCAGTAGAATGG + Intronic
1036438091 8:8754393-8754415 GTGTCAAAGCCCGACAAGAAAGG - Intergenic
1036702578 8:11022932-11022954 GACCCACAGACACACAGGAAAGG + Intronic
1037632809 8:20673542-20673564 GTCCCAAAGCCTCAAAAGTAGGG + Intergenic
1037802787 8:22044309-22044331 GTCAGACAGCCCCTCAAGCATGG - Intronic
1039598189 8:38809682-38809704 GTCCCACAGCCCCCAAAGAAAGG - Intronic
1040510413 8:48088343-48088365 ATCCCACAGGCCCACAGGACTGG - Intergenic
1042527415 8:69777931-69777953 ATCTCACATCACCACAAGAAGGG + Intronic
1043180879 8:77085175-77085197 GTCCCAAAACCTCACAAGTAGGG - Intergenic
1043716214 8:83490199-83490221 GTCCCAAAGCCTCAAAAGTAGGG + Intergenic
1045217433 8:100162299-100162321 GTTCCAAAGCCCCACAATGATGG - Exonic
1046770723 8:118113614-118113636 GTCCCACAGCCCCACTTCACAGG - Intergenic
1047994369 8:130319471-130319493 TTCCCATAGCCCTGCAAGAAGGG - Intronic
1048348693 8:133598168-133598190 GTCCCCCCGCCCCCCAAAAAAGG + Intergenic
1049450871 8:142660793-142660815 GTGCCACAGCCTCCCAAGAATGG + Intronic
1049968746 9:802618-802640 TTCCCAAAGCGCTACAAGAAGGG - Intergenic
1049988005 9:970254-970276 GTCCAATAGCCCCAGAAGAGAGG + Intergenic
1050053234 9:1624637-1624659 GTCCCAAAGCCTCAAAAGTAGGG - Intergenic
1051365409 9:16318251-16318273 GTCCCAAAGAGCCACGAGAAGGG - Intergenic
1051901198 9:22042826-22042848 GTCACACAATCACACAAGAATGG + Intergenic
1052097147 9:24396813-24396835 GTCCCAAAACCTCACAAGGAGGG - Intergenic
1052411659 9:28129144-28129166 GTCCCAAAGCCTCAAAAGTAGGG - Intronic
1052892021 9:33710236-33710258 GTACTACAGACCCACCAGAATGG + Intergenic
1053076906 9:35141188-35141210 GTCCCACTGCCTCCCTAGAAAGG + Intergenic
1055414687 9:76068729-76068751 GTGCCACAGCCACACACAAATGG + Intronic
1055428369 9:76218608-76218630 GACCTACAGCACCAGAAGAATGG - Intronic
1056100885 9:83299701-83299723 GTCCCGCATCACCACAGGAATGG + Intronic
1056131457 9:83590853-83590875 GGAACACAGCCCCACATGAATGG - Intergenic
1057399325 9:94708960-94708982 ATCACATAGCCCCACAAGTAGGG - Intergenic
1058096209 9:100862916-100862938 GTCCCAAAGCCCCAAAAGTAAGG - Intergenic
1058609730 9:106762660-106762682 TTCCCATAGCCTCACTAGAATGG + Intergenic
1059471080 9:114505241-114505263 GTCCCCCAGCCCTAGAGGAACGG - Intronic
1060727874 9:126017732-126017754 GTCCCAGAGCCCGACAAGTTGGG - Intergenic
1061296671 9:129680565-129680587 TTCCCCAAGCCCCACAGGAAGGG + Intronic
1061418025 9:130458568-130458590 GTCCCACGGCGCCACAGGAAAGG + Exonic
1061838728 9:133345545-133345567 CTCCCACAGCCCAAAAAGACCGG - Intronic
1062013330 9:134278419-134278441 CACCCACAGGCCCACAAGCAAGG + Intergenic
1185849163 X:3469199-3469221 GTCCCAAACCCCCAAAAGTAGGG - Intergenic
1186288268 X:8068979-8069001 GTCCAACAGCCTCAAAAGTAGGG - Intergenic
1186367050 X:8906584-8906606 GAGCCACAGCCCCAGAACAATGG + Intergenic
1187415132 X:19086712-19086734 GTCCCACTGCCCTCCAAGGAAGG + Intronic
1190561904 X:51694756-51694778 GTCCCGCAGCCTCAAAAGCAGGG + Intergenic
1191206539 X:57840096-57840118 GTCCCAAAGCCTCAAAAGTAGGG - Intergenic
1194303351 X:92213716-92213738 GTCCAAGAGCTCCAGAAGAATGG - Intronic
1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG + Intergenic
1196666720 X:118324973-118324995 GTCCCAAAACCTCACAAGTAGGG - Intergenic
1197710770 X:129665657-129665679 TTCCCACTCCCCCAGAAGAATGG - Intergenic
1197725532 X:129773896-129773918 GTCACACACACCCACAAGAAAGG + Intergenic
1198047447 X:132916796-132916818 GTCCCACAACCTCAAAAGTAGGG - Intronic
1200055224 X:153456707-153456729 GGCCCTCAGCCCCACAGGGAAGG + Intronic
1201865641 Y:18650918-18650940 GTTCCACAGCTCCAGGAGAAGGG + Intergenic