ID: 998747607

View in Genome Browser
Species Human (GRCh38)
Location 5:145278708-145278730
Sequence GGGTCCATCCAAGGAACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998747605_998747607 -6 Left 998747605 5:145278691-145278713 CCTACAATCAAGGGGAGGGGTCC No data
Right 998747607 5:145278708-145278730 GGGTCCATCCAAGGAACACAAGG No data
998747598_998747607 17 Left 998747598 5:145278668-145278690 CCAGAAATAAGTCACAGGTGCTG No data
Right 998747607 5:145278708-145278730 GGGTCCATCCAAGGAACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998747607 Original CRISPR GGGTCCATCCAAGGAACACA AGG Intergenic
No off target data available for this crispr