ID: 998749653

View in Genome Browser
Species Human (GRCh38)
Location 5:145305625-145305647
Sequence CTGACCAATGAAAAGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998749653_998749659 1 Left 998749653 5:145305625-145305647 CCATCCAGCTTTTCATTGGTCAG No data
Right 998749659 5:145305649-145305671 GCAAGAGAGGTCCCTGACCTGGG No data
998749653_998749658 0 Left 998749653 5:145305625-145305647 CCATCCAGCTTTTCATTGGTCAG No data
Right 998749658 5:145305648-145305670 GGCAAGAGAGGTCCCTGACCTGG No data
998749653_998749663 18 Left 998749653 5:145305625-145305647 CCATCCAGCTTTTCATTGGTCAG No data
Right 998749663 5:145305666-145305688 CCTGGGTCCTGTTTTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998749653 Original CRISPR CTGACCAATGAAAAGCTGGA TGG (reversed) Intergenic
No off target data available for this crispr