ID: 998753864

View in Genome Browser
Species Human (GRCh38)
Location 5:145353975-145353997
Sequence TCTTCTCTTGACCAAGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998753862_998753864 16 Left 998753862 5:145353936-145353958 CCATCTCCAGTGGTTATGGTGAA No data
Right 998753864 5:145353975-145353997 TCTTCTCTTGACCAAGAGTTAGG No data
998753863_998753864 10 Left 998753863 5:145353942-145353964 CCAGTGGTTATGGTGAAATTTAA No data
Right 998753864 5:145353975-145353997 TCTTCTCTTGACCAAGAGTTAGG No data
998753857_998753864 30 Left 998753857 5:145353922-145353944 CCTTACCATCCTTACCATCTCCA No data
Right 998753864 5:145353975-145353997 TCTTCTCTTGACCAAGAGTTAGG No data
998753860_998753864 21 Left 998753860 5:145353931-145353953 CCTTACCATCTCCAGTGGTTATG No data
Right 998753864 5:145353975-145353997 TCTTCTCTTGACCAAGAGTTAGG No data
998753859_998753864 25 Left 998753859 5:145353927-145353949 CCATCCTTACCATCTCCAGTGGT No data
Right 998753864 5:145353975-145353997 TCTTCTCTTGACCAAGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998753864 Original CRISPR TCTTCTCTTGACCAAGAGTT AGG Intergenic
No off target data available for this crispr