ID: 998761547

View in Genome Browser
Species Human (GRCh38)
Location 5:145437810-145437832
Sequence ATGCTGCTATTAAAGAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998761545_998761547 14 Left 998761545 5:145437773-145437795 CCTAATAATCTCAAAACTGGATC No data
Right 998761547 5:145437810-145437832 ATGCTGCTATTAAAGAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998761547 Original CRISPR ATGCTGCTATTAAAGAAATA TGG Intergenic
No off target data available for this crispr