ID: 998762286

View in Genome Browser
Species Human (GRCh38)
Location 5:145445854-145445876
Sequence AAATATTAGCAAATGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998762281_998762286 25 Left 998762281 5:145445806-145445828 CCACTGTGGAGTATCATCTCCAG No data
Right 998762286 5:145445854-145445876 AAATATTAGCAAATGCTGGTGGG No data
998762283_998762286 6 Left 998762283 5:145445825-145445847 CCAGATAGAATGGCTATTATCAA No data
Right 998762286 5:145445854-145445876 AAATATTAGCAAATGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998762286 Original CRISPR AAATATTAGCAAATGCTGGT GGG Intergenic
No off target data available for this crispr