ID: 998765469

View in Genome Browser
Species Human (GRCh38)
Location 5:145482092-145482114
Sequence AGTTATGTGATAAAGATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 249}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998765469_998765471 25 Left 998765469 5:145482092-145482114 CCTGTCATCTTTATCACATAACT 0: 1
1: 0
2: 1
3: 17
4: 249
Right 998765471 5:145482140-145482162 TATGTGCTTCAAGCCATGAAAGG No data
998765469_998765472 26 Left 998765469 5:145482092-145482114 CCTGTCATCTTTATCACATAACT 0: 1
1: 0
2: 1
3: 17
4: 249
Right 998765472 5:145482141-145482163 ATGTGCTTCAAGCCATGAAAGGG 0: 1
1: 0
2: 0
3: 14
4: 169
998765469_998765473 27 Left 998765469 5:145482092-145482114 CCTGTCATCTTTATCACATAACT 0: 1
1: 0
2: 1
3: 17
4: 249
Right 998765473 5:145482142-145482164 TGTGCTTCAAGCCATGAAAGGGG 0: 1
1: 0
2: 0
3: 12
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998765469 Original CRISPR AGTTATGTGATAAAGATGAC AGG (reversed) Intronic
900870712 1:5300676-5300698 AGGTATGTGAGGAAAATGACGGG - Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
908377899 1:63564174-63564196 ATATATGTGATAAGGAAGACGGG - Intronic
908832915 1:68198827-68198849 GGTTATGTTGTAACGATGACTGG - Intronic
908977341 1:69913951-69913973 GATTATGTGATAAAATTGACAGG + Intronic
909775573 1:79480705-79480727 AGTTCTGTGAAAAATATCACTGG - Intergenic
910565674 1:88640074-88640096 AGTTATCTGAGAATGATGGCAGG + Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
913041001 1:115023003-115023025 AGCTGTGTGAAGAAGATGACTGG + Intergenic
913411081 1:118552316-118552338 GGTTATGGTATGAAGATGACTGG - Intergenic
914259397 1:145986199-145986221 AGTGATGGGAGAAAGAAGACAGG - Intergenic
915518293 1:156426572-156426594 AGTTCTGTGATAGAGAGGAAAGG - Intronic
915650390 1:157306265-157306287 AGTCAGGTGATACAGATGACTGG + Intergenic
917336543 1:173929432-173929454 AGGTAGGTGATTAAGATGACAGG + Intergenic
920100933 1:203516616-203516638 AGTTCTGTGGCACAGATGACAGG + Intergenic
920923547 1:210319945-210319967 AATTATCTCATAAAGATGATGGG + Intergenic
921763025 1:218939286-218939308 AGTTAGGTGAAGAAGGTGACTGG - Intergenic
922121864 1:222678726-222678748 AGCTATGTGATTAAGACGACAGG + Intronic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
924208939 1:241744919-241744941 AGTAATGTGACAAAGTTGGCTGG - Intronic
1064700134 10:18010004-18010026 AGTTATATGATGAAGAAGAGAGG - Intronic
1066314636 10:34232286-34232308 ATCTATTTGGTAAAGATGACTGG + Intronic
1066646657 10:37617591-37617613 TGTTTTGTAATAAAGATAACTGG - Intergenic
1068012669 10:51473692-51473714 TGTTATGTTTTAAAGATCACAGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068884204 10:62081523-62081545 TGTTGTGTAATAAAGATGAAGGG + Intronic
1069143244 10:64855355-64855377 TGTTATGAGATAAAGATAAATGG - Intergenic
1074911879 10:117918377-117918399 AAGTATATGATAAAAATGACTGG + Intergenic
1078024908 11:7685577-7685599 AGTTATCTGAGAAAGCTGCCTGG - Intergenic
1079796502 11:24810284-24810306 ACTTATATGCTAAATATGACAGG - Intronic
1079890427 11:26045757-26045779 AGTTAAGTGAGGAAGGTGACAGG - Intergenic
1080110228 11:28558484-28558506 AATGATATGATAAAGATTACAGG + Intergenic
1080191632 11:29557190-29557212 TGTTAGGTGATAAATATAACTGG + Intergenic
1081822275 11:46011050-46011072 AGTTTTGTGATAAAGGGGAAAGG - Intronic
1082677276 11:56121010-56121032 AGTTATGTGTCAAAGAAGACCGG - Intergenic
1085482869 11:76837247-76837269 AGGTATGTGAGAGAGATGAGAGG - Intergenic
1085694483 11:78692303-78692325 AGTAATGTGATCTAGAGGACGGG + Intronic
1086265784 11:84996351-84996373 AGTTAAGAGACATAGATGACAGG - Intronic
1087153256 11:94877520-94877542 AGTAATGTGCAAAAGATGGCAGG + Intergenic
1089165597 11:116473789-116473811 ATTTATATGATAAAGATGCTGGG - Intergenic
1090675499 11:128990578-128990600 GGTTATGTAGTAAAGATGAAGGG + Intronic
1093049672 12:14490990-14491012 AGTTACCTGCAAAAGATGACAGG + Intronic
1093059850 12:14590440-14590462 AGTTGAGTGATGAAGATGGCAGG - Intergenic
1095461600 12:42450017-42450039 AGCTGTGTGCTGAAGATGACAGG + Intronic
1095599347 12:43997500-43997522 ATTTCTTTGCTAAAGATGACTGG + Intronic
1096173055 12:49489448-49489470 ATTTATCTGGAAAAGATGACAGG - Exonic
1097814383 12:64056162-64056184 ATTTAGGAGGTAAAGATGACAGG - Intronic
1097970074 12:65624041-65624063 GGTGATGTGATAGAGATGACTGG - Intergenic
1098078079 12:66755108-66755130 AATTTTCTGATAAAGATCACAGG - Intronic
1098357897 12:69628292-69628314 AGTTATGAAAAAAAGATGAAAGG + Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1105585210 13:21737227-21737249 AGTCATGGGATAAAAATGACTGG + Intergenic
1105618102 13:22039761-22039783 AGTTAAAAGATAAAGATGGCCGG - Intergenic
1107861361 13:44664175-44664197 ATTTATGGGATAAAGCTGTCAGG + Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108193700 13:47970430-47970452 AGTTACGTGAAGATGATGACTGG - Intronic
1108863920 13:54898845-54898867 AATTATGTGATAGAGATAAACGG + Intergenic
1109447278 13:62458134-62458156 ATTTATGAAATAAAAATGACAGG - Intergenic
1110230164 13:73159668-73159690 AGTTCTGTGAAAAATATCACTGG - Intergenic
1111524674 13:89452735-89452757 TGTTATAGGATAAAGGTGACAGG - Intergenic
1113306664 13:109086774-109086796 AGTAATATAACAAAGATGACTGG - Intronic
1113640745 13:111955209-111955231 ACATCTGTGATAAAGATAACAGG - Intergenic
1114987393 14:28248163-28248185 AGATATTTTATAAAGATAACAGG + Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115334237 14:32229282-32229304 ATATATGTTATAAAGATTACTGG + Intergenic
1115751382 14:36495317-36495339 AGTCATTTGATAAAGATAATTGG - Intronic
1118913106 14:70078295-70078317 AGGGATGTGGTAAAGATGAATGG - Intronic
1119072142 14:71597455-71597477 ATAAATGTGATAAAGATCACTGG - Intronic
1121669904 14:95701069-95701091 AATTATATGATAAAGATGAAAGG + Intergenic
1122908444 14:104814351-104814373 AGTCATGTGAGAACGCTGACCGG - Intergenic
1125249874 15:37688648-37688670 AGTTATGGGACAAAGCTGATTGG - Intergenic
1128029974 15:64471465-64471487 AGTAATGTGCTATAGATGGCTGG - Intronic
1128036648 15:64532826-64532848 AGCTAGGTGAAAAAGAGGACTGG + Intronic
1128231797 15:66040429-66040451 TGTTATGTGAGAAAGAGGCCGGG - Intronic
1130104074 15:80915949-80915971 AGCCATGTTATAAAGAAGACTGG - Intronic
1130576604 15:85098318-85098340 AGTTGTGTGATAATACTGACTGG + Intronic
1132402738 15:101523366-101523388 AGTCAAGTTAGAAAGATGACAGG + Intronic
1134395634 16:13860405-13860427 AGTTTTGTGATATGGATGATTGG + Intergenic
1138005230 16:53328953-53328975 TGTTTTGTGATAAAGGAGACCGG + Exonic
1139301031 16:65945511-65945533 AGTTATGTGATGAGGAGGACAGG + Intergenic
1139793987 16:69467140-69467162 ATATATGTGATTAAGCTGACTGG - Intergenic
1139854237 16:69968035-69968057 AGCCATGTGCTAAAGATGTCAGG - Intergenic
1139883217 16:70190949-70190971 AGCCATGTGCTAAAGATGTCAGG - Intergenic
1140171970 16:72615103-72615125 ATTTATGTGATAAAGTTGTTAGG + Intergenic
1140295639 16:73707053-73707075 AGTTATGTAATAAAGTATACTGG - Intergenic
1140369290 16:74404572-74404594 AGCCATGTGCTAAAGATGTCAGG + Intergenic
1140961425 16:79916663-79916685 AGATATATGATGGAGATGACAGG - Intergenic
1144302439 17:13934391-13934413 AGTAATATGATAAAAATCACTGG + Intergenic
1146836352 17:36113973-36113995 AGTTATCTGAACAAGATGGCAGG - Intergenic
1148255863 17:46131565-46131587 ATTCATGTGATGAAGATGATGGG - Intronic
1148918571 17:51006757-51006779 AGTCATGTGGAAAAGCTGACTGG - Intronic
1149688874 17:58556529-58556551 TGTTATGAGACACAGATGACTGG + Intergenic
1150118643 17:62579304-62579326 ATTAATGTATTAAAGATGACTGG - Intronic
1150968914 17:70004395-70004417 TGTAATGTGAGAAAGACGACTGG - Intergenic
1154100199 18:11465831-11465853 AGTAAAGTGATAAGGATGCCAGG - Intergenic
1154134733 18:11766296-11766318 ATTTATGCCATGAAGATGACAGG - Intronic
1155879208 18:31123084-31123106 AGATATGTAATAATGATGTCAGG - Intergenic
1155880321 18:31139860-31139882 AGTTAGGGGATGAAGATAACTGG - Exonic
1158193324 18:54855895-54855917 GGTTGTATAATAAAGATGACTGG - Intronic
1158403881 18:57144286-57144308 AGTGATGTGGTCAAGGTGACTGG + Intergenic
1158828033 18:61246414-61246436 AGTCATGTAATAGAGATGAAGGG - Intergenic
1165283953 19:34822256-34822278 AGTTATTTGATAATGATAAAAGG + Intergenic
1165567816 19:36746756-36746778 AGTTATGGGCTAAAGTAGACAGG + Exonic
1165676993 19:37734756-37734778 AGTTATGTGGCAGTGATGACAGG + Intergenic
1166654223 19:44598524-44598546 AGTTATGTACTGAAGATGACAGG - Intergenic
1167742844 19:51334637-51334659 AGTGATGTGATAGAGATAATGGG + Intronic
925559229 2:5170713-5170735 AGATAGGTGAAAAAGGTGACAGG - Intergenic
925648500 2:6063306-6063328 AGCTATGTGATCAAGATTATAGG - Intergenic
926773396 2:16398153-16398175 TGAAAAGTGATAAAGATGACTGG - Intergenic
927160846 2:20258971-20258993 AGTTATATATTAAAGATGAAGGG - Intronic
930152493 2:48072918-48072940 AATTATTTGATAAAAAGGACAGG - Intergenic
930705241 2:54498767-54498789 ATTTATTTGATAAATATGTCTGG + Intronic
931443852 2:62310156-62310178 TGTGATGGGATAAAAATGACTGG - Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
936121637 2:109751214-109751236 ATTTATGTGAAACAAATGACTGG + Intergenic
936223060 2:110620260-110620282 ATTTATGTGAAACAAATGACTGG - Intergenic
937266715 2:120620865-120620887 ATTTAGTTGATAAAGAAGACAGG - Intergenic
937588398 2:123584588-123584610 TGTTATGTGACAAAGGTGAAAGG + Intergenic
941330671 2:164174594-164174616 ACTTATCTGACAAAGATGGCAGG + Intergenic
942505281 2:176635717-176635739 AGCTATGTGATAAAAATTATTGG - Intergenic
943261693 2:185672842-185672864 AATTATGTGATAATATTGACTGG + Intergenic
947384374 2:229576715-229576737 AGTAATGTGAGACACATGACTGG + Intronic
947523940 2:230867196-230867218 AGTTCTGTCCTAAAGATGCCAGG - Intronic
1171335668 20:24383180-24383202 AGTCATTTGCTAAAGATGTCAGG - Intergenic
1172591655 20:36122202-36122224 ACTTATCTGAGAAACATGACAGG - Intronic
1172856261 20:38005397-38005419 ATTTATATGATAAAGAAGAAGGG - Intronic
1173589750 20:44215424-44215446 ATTTATTTTAGAAAGATGACTGG + Intergenic
1173690786 20:44959740-44959762 GGTGATGTGATAGAGTTGACTGG - Intronic
1177844547 21:26273260-26273282 AGATATGTGATTTACATGACAGG + Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1179480612 21:41675112-41675134 ATTTATGTGCTAAAAATCACAGG - Intergenic
1181782715 22:25204785-25204807 AGTTATGTGACAAAGAGAAAGGG - Intronic
1181840812 22:25658843-25658865 ATTTTTTTGATAAAGAAGACTGG + Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
949832599 3:8231827-8231849 AATTATTTGAGAAAGATGAAAGG + Intergenic
950160796 3:10759232-10759254 AGTTATGTGATAAAGATGGTGGG - Intergenic
952601330 3:35087121-35087143 AATTATGTTATAAAAATTACTGG - Intergenic
952603503 3:35114037-35114059 AACTATGTGATAAATTTGACGGG - Intergenic
955110824 3:55947968-55947990 ACTTATGAAATAAAGAAGACTGG + Intronic
955677016 3:61459375-61459397 ACTTATGTGAAAATGATGGCTGG - Intergenic
956150927 3:66241495-66241517 AGTGATGTCATTAAGATCACAGG + Intronic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957382071 3:79444953-79444975 AGTGATGAGATTAAGATGGCAGG + Intronic
957382371 3:79448728-79448750 AATTATATGATAACAATGACAGG - Intronic
959122411 3:102248306-102248328 ATTTATATGAGACAGATGACAGG - Intronic
964369469 3:155984864-155984886 AGTTGCATAATAAAGATGACAGG - Intergenic
965265903 3:166543225-166543247 AGTGCTGTGATAAAGCTGGCAGG - Intergenic
965431630 3:168595978-168596000 AGTGACATGATAAAGTTGACAGG + Intergenic
965841516 3:172910981-172911003 AGCTCTGTGATAAATATGGCTGG + Intronic
966346532 3:178987143-178987165 AATTATGTGATGACGATGAGAGG + Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
973317474 4:48777808-48777830 ATTTCTGTGATAAGGATGTCAGG - Intronic
974882554 4:67777858-67777880 AGTTATCTGAAAAAGAGGTCTGG + Intergenic
975166303 4:71181835-71181857 AGAGATGTGATAGAGTTGACAGG - Intergenic
975883178 4:78935597-78935619 AGTAGTGTCATAAAGATGAATGG - Intronic
976386910 4:84470574-84470596 AGTTATGTGCCAAAGAGGAAAGG + Intergenic
976480961 4:85544808-85544830 AATTATCTGAGAAAGATGAAAGG - Intronic
976708909 4:88047953-88047975 AATTAAGTGATAAGGATGAAGGG - Intronic
976847653 4:89508689-89508711 AGTCTTGGGATAAAGCTGACAGG + Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977404030 4:96573465-96573487 AGTTATATAATAAACATAACTGG + Intergenic
978552317 4:109940370-109940392 ATTTATGTGGTAAAGATAACAGG + Intronic
980462869 4:133139527-133139549 AGTTATGGAATAAAGAAGACTGG + Intergenic
980982438 4:139666005-139666027 AGTTCCGTGAGAAAGATGGCCGG + Exonic
981397250 4:144267227-144267249 AGTTCTGTGATAGTGATGCCAGG - Intergenic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
983303079 4:165952452-165952474 AGTTATGGGATGAAGTAGACAGG + Intronic
984544300 4:181081893-181081915 AGTTATTTGGTAAAGATAATGGG + Intergenic
984617734 4:181917335-181917357 TGTTATGTGCTATAGATAACTGG - Intergenic
986162764 5:5245862-5245884 AGTTATGTCATAAAAGTGAGAGG - Intronic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
987751812 5:22049132-22049154 AGTTATGGGTTAAAGATCCCTGG + Intronic
988101478 5:26684879-26684901 CTTTATGTGATAAAGTTGAAAGG + Intergenic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
988969550 5:36452742-36452764 ATTTATGTGTTTAAGAGGACAGG - Intergenic
989235202 5:39140036-39140058 ATTTATGTGATAAAGTCTACAGG + Intronic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
989641718 5:43589337-43589359 AGGTAGCTGATAGAGATGACTGG + Intergenic
990167780 5:53014128-53014150 AGTAATATGATAAATAGGACTGG + Intronic
991905441 5:71505301-71505323 TGTTAAGTGATAAAGCTGGCTGG - Intronic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
994847448 5:105007877-105007899 ACTTATTTGTTAAAGATAACAGG + Intergenic
995382344 5:111549125-111549147 AGTTAAGTGCTGAAAATGACTGG - Intergenic
996998859 5:129733850-129733872 AGTGCTGTGATAAACATGAGTGG - Intronic
997623450 5:135315696-135315718 ATATTTGTGATAAAGATGACAGG - Intronic
998323915 5:141261427-141261449 AGTTATGTGAGATAGCTGAAAGG - Intergenic
998765469 5:145482092-145482114 AGTTATGTGATAAAGATGACAGG - Intronic
999990577 5:157046366-157046388 AGTTAGCTGGGAAAGATGACAGG + Intronic
1000291639 5:159876618-159876640 AGTTCTGTGAAAAAGAAGATGGG + Intergenic
1002804100 6:555473-555495 ACTTATGTGATAGATATGGCTGG - Intronic
1005348605 6:24912914-24912936 AGCTATGGGAAAGAGATGACAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009716206 6:67399674-67399696 AGCTATGTGAGAAAAAGGACAGG + Intergenic
1009953079 6:70418964-70418986 AGTTCTGTGCTATAGGTGACTGG + Intronic
1011729779 6:90249321-90249343 AGTTATGGGAGGAAGATGACAGG - Intronic
1011854685 6:91675120-91675142 AGTTATGACAAAATGATGACAGG - Intergenic
1014126294 6:117780360-117780382 AATGATGTGATAGAGATCACAGG + Intergenic
1014148019 6:118020865-118020887 AGTTATCTGAGAAAATTGACTGG + Intronic
1014264221 6:119256701-119256723 AGTTATGTCATAAAGAAAATGGG + Intronic
1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG + Intergenic
1014906077 6:127029682-127029704 AGTAATGTGATGAAGATGATTGG + Intergenic
1016101648 6:140108923-140108945 GATTATGCGAAAAAGATGACTGG + Intergenic
1016722327 6:147315563-147315585 AGTCAAGAAATAAAGATGACAGG + Exonic
1021851356 7:24811905-24811927 AGTTATTTAATAAAAATGAATGG + Intronic
1024857885 7:53802686-53802708 AGCTATACGCTAAAGATGACAGG - Intergenic
1024861215 7:53843910-53843932 AGTTTTGGGATAAAGATGGAGGG - Intergenic
1024866099 7:53906315-53906337 AGTTATCTGAAAAAGGTGGCAGG - Intergenic
1026144326 7:67733073-67733095 AGATAGGTGATAGAGATGATAGG - Intergenic
1027378618 7:77579936-77579958 GGTTATGTAATAAGGGTGACTGG - Intronic
1028896547 7:96048068-96048090 AGTTATCTGTTAACGATGATGGG + Intronic
1029848258 7:103435915-103435937 AGTCAAATGTTAAAGATGACAGG - Intronic
1030436010 7:109521602-109521624 AGATATGTGATCAAAATAACTGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1033067120 7:138166852-138166874 TGATATGAGATAAAGACGACTGG + Intergenic
1033179699 7:139163777-139163799 AGTCATGGGATCAAGAAGACAGG + Intronic
1035529017 8:336794-336816 AGTTGGGTGATGAAGATGACAGG + Intergenic
1036585988 8:10124100-10124122 AGTGAAGTGATAAAGACCACTGG + Intronic
1037891242 8:22624723-22624745 CGTTGTGTGATAAAGCTCACAGG - Intronic
1038829504 8:31041562-31041584 AATTATGTGATATAGATTTCAGG + Intronic
1039795653 8:40911710-40911732 AGAAAATTGATAAAGATGACTGG + Intergenic
1041253106 8:55953892-55953914 AGCCATGGGATAAAGATGCCTGG + Exonic
1041541918 8:58994595-58994617 AATTGTGTTATAAAGATAACAGG + Intronic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042209942 8:66369915-66369937 AGTTAAGTGATGAAGGTTACAGG - Intergenic
1043121784 8:76334768-76334790 AGTTGTATGTTAAAGATTACAGG - Intergenic
1043287284 8:78549132-78549154 GTTTATGTGATTTAGATGACTGG + Intronic
1043628143 8:82290357-82290379 AGTGCTGTGTTGAAGATGACTGG + Intergenic
1046203903 8:110963590-110963612 AGTTATATGTTAATTATGACAGG - Intergenic
1047229077 8:122980578-122980600 AATTATGAGATAAAAATGAAAGG + Intergenic
1048834988 8:138510388-138510410 ATTTATAGGGTAAAGATGACAGG - Intergenic
1050303709 9:4285483-4285505 AGCTATATGATAAAAATTACAGG + Intronic
1051190868 9:14510742-14510764 AATTATGAGATAAAGATTTCTGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1055471506 9:76616246-76616268 AGGTATATGAAAAAGATGTCGGG - Intronic
1056006204 9:82274139-82274161 ATTTATGAGCTACAGATGACAGG - Intergenic
1056039910 9:82654078-82654100 TGTTATGTGATATAGGTGTCTGG + Intergenic
1056334829 9:85557658-85557680 AGCTATGTGGTAAAGTTTACTGG - Intronic
1058579096 9:106435526-106435548 AGTGATGTGAGAAAGATGGAAGG - Intergenic
1059126397 9:111690509-111690531 ATTTCTGTGATAAACATAACTGG - Intronic
1185953830 X:4466926-4466948 AGTTAGTAGATAATGATGACAGG + Intergenic
1188466087 X:30482847-30482869 AGTGCTGTAATAAACATGACGGG - Intergenic
1188517249 X:31000717-31000739 AGTTATGTGGTATGGATGCCAGG - Intergenic
1191630040 X:63312619-63312641 AGTTATCTGAAGAAGTTGACAGG + Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192711090 X:73589689-73589711 AGGCATGTGATAAAGAACACTGG - Intronic
1192751808 X:73999699-73999721 AGATATGTGATTAACCTGACAGG + Intergenic
1193407194 X:81116584-81116606 AGTTGAGTGATATAGATGAGAGG + Intronic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194252460 X:91593198-91593220 AATTATCTGATAAAGATTAAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194521079 X:94919407-94919429 AGTTATCTGCAAAAGATGACAGG - Intergenic
1195175318 X:102309428-102309450 AGAAAAGGGATAAAGATGACTGG + Intronic
1195183547 X:102377665-102377687 AGAAAAGGGATAAAGATGACTGG - Intronic
1195451513 X:105019012-105019034 ACAACTGTGATAAAGATGACTGG - Intronic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197276058 X:124480881-124480903 AGTTAAATAATTAAGATGACAGG + Intronic
1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200571391 Y:4834443-4834465 AATTATCTGATAAAGATTAAAGG - Intergenic
1201413920 Y:13728688-13728710 AGTTATTTGACAAACATTACTGG - Intergenic
1201983479 Y:19933837-19933859 ATTTATGAGACAAAGATAACTGG + Intergenic