ID: 998768877

View in Genome Browser
Species Human (GRCh38)
Location 5:145519085-145519107
Sequence ACTTCTCTGGTGGAGCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 4, 3: 6, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998768872_998768877 -9 Left 998768872 5:145519071-145519093 CCCTCAGCACCAAGACTTCTCTG 0: 1
1: 0
2: 1
3: 24
4: 294
Right 998768877 5:145519085-145519107 ACTTCTCTGGTGGAGCTGCATGG 0: 1
1: 0
2: 4
3: 6
4: 151
998768871_998768877 -5 Left 998768871 5:145519067-145519089 CCTGCCCTCAGCACCAAGACTTC 0: 1
1: 0
2: 3
3: 37
4: 268
Right 998768877 5:145519085-145519107 ACTTCTCTGGTGGAGCTGCATGG 0: 1
1: 0
2: 4
3: 6
4: 151
998768873_998768877 -10 Left 998768873 5:145519072-145519094 CCTCAGCACCAAGACTTCTCTGG 0: 1
1: 0
2: 3
3: 23
4: 281
Right 998768877 5:145519085-145519107 ACTTCTCTGGTGGAGCTGCATGG 0: 1
1: 0
2: 4
3: 6
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998768877 Original CRISPR ACTTCTCTGGTGGAGCTGCA TGG Intronic
904052136 1:27646160-27646182 ACTGCTGTGGCGGAGCTGGAGGG - Intergenic
904453915 1:30635611-30635633 ACATGTGTGGTGGAGCTGGACGG - Intergenic
910465500 1:87494853-87494875 TCTTCTCAGTTGGTGCTGCAAGG - Intergenic
915795966 1:158733745-158733767 TCTGCTCTGGTGGGGCTGCATGG + Intergenic
916590849 1:166188654-166188676 ACTTCTTATGTGGAGGTGCAGGG + Intergenic
920414768 1:205791606-205791628 ACTGCTCTGGGGGACCTGCTTGG - Exonic
920599063 1:207303936-207303958 TCTTCTATGGTCGAGCTGTAGGG - Intergenic
921623711 1:217354863-217354885 ACTTCCCTTGTGGAGTTGCTGGG + Intergenic
1062860795 10:807657-807679 CCTGCCCTGGTGGAGCTGGAGGG - Exonic
1062909532 10:1203850-1203872 ACTTCTCAGGTGATGCTCCATGG - Intronic
1066295066 10:34046942-34046964 AAGACTCTGGTGGAGGTGCACGG - Intergenic
1067053765 10:43039794-43039816 CCTTCCCTGGCTGAGCTGCATGG - Intergenic
1069622310 10:69845529-69845551 CCTACTTTGGTGTAGCTGCAGGG - Intronic
1070644315 10:78190951-78190973 ACTTCGCTGGTGCTGGTGCAGGG - Intergenic
1070823704 10:79379092-79379114 AGTTCTCTGGGGGAGTAGCAAGG + Intergenic
1070948610 10:80413164-80413186 ATTTCTCTGCTGGAGTTCCATGG - Intronic
1075093283 10:119455142-119455164 CCTGCTCTGGTGGGGCTGCCAGG + Exonic
1076134375 10:128035668-128035690 ACTACCCTCTTGGAGCTGCAGGG + Intronic
1076339145 10:129730981-129731003 ACGCCTCTGGGGGAGCTTCAAGG + Intronic
1076361637 10:129893885-129893907 GCTTCCCTGGTGGGGGTGCACGG + Intronic
1076581232 10:131513357-131513379 ACTTCCCAGGGGGAGCTGGAAGG - Intergenic
1078142713 11:8703439-8703461 ACTTCTCTGGGGGAGTCACAGGG + Intronic
1078931808 11:15918383-15918405 ATTTGTCGAGTGGAGCTGCAAGG - Intergenic
1079326597 11:19498175-19498197 TCTTCTCTGGAGGAGCCACATGG - Intronic
1079478274 11:20854456-20854478 ACTTCTGTAGTGGACCTACAGGG + Intronic
1081930555 11:46867982-46868004 ACGTCTCTGGAGGAGGTGGAAGG - Exonic
1085531471 11:77194599-77194621 ACCTCTCTGTTGGGGCTGCGGGG + Intronic
1087953479 11:104254714-104254736 ACTTCTGTGGAGGTGCTGCGTGG - Intergenic
1090374435 11:126278957-126278979 ACTTCCCTCGAGGAGCTTCATGG - Intergenic
1090756765 11:129798546-129798568 CCTTCTCTGGTGGAGGTGGCAGG - Intergenic
1097978829 12:65716167-65716189 ATTGATCTGGTGGTGCTGCAGGG + Intergenic
1102482943 12:113236409-113236431 ACTCCCCTGGCTGAGCTGCATGG - Intronic
1102721011 12:115016071-115016093 ACTTCTCTGTTGGATCTACTTGG + Intergenic
1103925099 12:124419301-124419323 GCTGCTCTGGTGGAGTTGCATGG - Intronic
1106949975 13:34872474-34872496 ACTTCTCTAGTGGAACTTCTTGG - Intergenic
1106952054 13:34895198-34895220 TCTTTTCTGGTGGGGCTCCAAGG - Intergenic
1111877142 13:93911594-93911616 CCTTTTTTGGTTGAGCTGCAAGG - Intronic
1114694266 14:24612107-24612129 CCTGCTCTGGTGGAGGTGGAAGG + Intergenic
1114928356 14:27434127-27434149 ACTTCTCTGTGGGAACTGAAGGG + Intergenic
1122992018 14:105240984-105241006 ACTTCTGGGGTGCGGCTGCATGG - Intronic
1125399586 15:39286632-39286654 AGTTCACTGGAGGAGATGCAGGG - Intergenic
1126789769 15:52210384-52210406 ACTTCTCTTTTGGAGGGGCATGG + Intronic
1131330875 15:91498163-91498185 ATTTCTCTGGTGGGGCTTAAAGG - Intergenic
1134043791 16:11086939-11086961 ACATCTCAGGTGGTGCTGGAGGG - Intronic
1136635328 16:31517874-31517896 ATCTCTCTGGAGGTGCTGCAGGG - Intergenic
1136665819 16:31811412-31811434 ATCTCTCTGGAGGTGCTGCAGGG - Intergenic
1137786055 16:51138757-51138779 AGTTCTCTCGTGAATCTGCAGGG + Exonic
1138093640 16:54195576-54195598 ACATCTCTGGGTGAGCTGTAAGG - Intergenic
1142210248 16:88805207-88805229 GCTTCCCTGGGGGAGCTGCGTGG + Intronic
1142717679 17:1755819-1755841 GCTTCCCTGCTGGAGGTGCAGGG + Intergenic
1143662337 17:8333527-8333549 GCTTCCCTGATGGTGCTGCAAGG + Intergenic
1144305914 17:13969463-13969485 ACTGCTCTGGTGGAGCTGAAAGG + Intergenic
1144781254 17:17809708-17809730 ACCTATCTTGGGGAGCTGCAGGG - Intronic
1145292978 17:21564518-21564540 CCTTCTCTGTTGGGGCTTCATGG - Intronic
1146595492 17:34164873-34164895 ACCTCCCTGCTAGAGCTGCACGG - Intronic
1153606190 18:6835974-6835996 CCTGCTCTGATGGAGCTACAGGG + Intronic
1153968390 18:10202708-10202730 ACCTGTCTGGAAGAGCTGCAGGG + Intergenic
1157446048 18:47747672-47747694 GCTTCCCAGGTGGAGCTGGAAGG - Intergenic
1157806061 18:50658447-50658469 ACTTCCCTCTTGGAGCTCCATGG + Intronic
1157985392 18:52431905-52431927 ATTTCTCTAGTTGAGCTCCAAGG - Intronic
1158587820 18:58756519-58756541 CCTCCCCTGGTGGAGTTGCACGG - Intergenic
1158587967 18:58757380-58757402 CCTCCCCTGGTGGAGTTGCACGG + Intergenic
1161775891 19:6261984-6262006 GCTTCTCTAGGGGAGCTGCTGGG - Intronic
1161780551 19:6289008-6289030 CCTTCTCAGGAGAAGCTGCAAGG + Intergenic
1162333252 19:10043547-10043569 ACTGCTCTGGTGGAGCATCTGGG - Intergenic
1162494884 19:11018111-11018133 ACCTCCCTCGTGGAGCTGCTTGG + Intronic
1163538560 19:17892932-17892954 ACTTCTCTAGGGCAGCTGGAGGG - Intronic
1164146848 19:22517769-22517791 ACTTCAGTGCTGGAGGTGCAGGG + Intronic
1166755270 19:45187015-45187037 ACCTCTCCAGTGGAGCTGCAGGG - Intronic
1166863762 19:45824054-45824076 CCATGTCTGGAGGAGCTGCAGGG - Intronic
1167598850 19:50442003-50442025 ACTTCTCTGGTGGTGATGCAGGG - Intronic
1168448242 19:56441942-56441964 AATTCTCTGGTGAAGCATCAGGG + Exonic
925093365 2:1173071-1173093 ACTTCTCTTGTTTTGCTGCAGGG + Exonic
925102484 2:1259891-1259913 ACCTCACTGGTGGGGCTGCCCGG + Intronic
925734342 2:6948194-6948216 AATACTCTGATGGTGCTGCAGGG + Intronic
925931982 2:8715359-8715381 ACTTCTCTGGAGGAGCTGTAAGG + Intergenic
928650188 2:33395850-33395872 AATTCTCCAGTGGAACTGCAGGG - Intronic
930489520 2:52050807-52050829 TCTTCTATGGTTGAGCTGTAGGG + Intergenic
930528776 2:52565008-52565030 ATTTCACTGGTGGAGTTTCATGG + Intergenic
931640873 2:64380099-64380121 ACTTCTATGGTGGTGTTGCCTGG - Intergenic
931917249 2:66969555-66969577 GCTTCCCTGGGGCAGCTGCATGG - Intergenic
932297519 2:70639420-70639442 CCTGCTCTGGGGGAGCTCCAGGG + Intronic
934895658 2:98117537-98117559 AATGCTCTGGTGGGGCAGCAGGG + Intronic
935155512 2:100480611-100480633 ACTGGTCTGGAGGGGCTGCAGGG - Intronic
937242501 2:120471373-120471395 GCTTCTCTGGAGAGGCTGCATGG + Intergenic
942021049 2:171866946-171866968 ACTTCTCTGATGGGGCGGCCAGG + Intronic
946052837 2:216878434-216878456 GCTTCTCTGCTGGTGCTGAAGGG - Intergenic
947108476 2:226693031-226693053 ACTTTTCTCGTGAAGCTGCAAGG - Intergenic
948352029 2:237348729-237348751 ACTTCTCAGGGGCAGCGGCAGGG - Intronic
1170304736 20:14925916-14925938 ACCTCTCTGGTGGAGTTTAATGG + Intronic
1170873239 20:20227532-20227554 ACTTCCCTGCAGAAGCTGCAAGG - Intronic
1171251980 20:23655805-23655827 ACTTGGCTGCTGGGGCTGCAGGG + Intergenic
1171343370 20:24447424-24447446 GCTTCTGTGGTGAAGCTGGAAGG + Intergenic
1175256677 20:57652167-57652189 ACTGCTCTGCTGGTGCTGGAAGG + Exonic
1178693111 21:34766559-34766581 ACTTCTCTGGTGCAAGAGCAGGG - Intergenic
1180604384 22:17046072-17046094 TCGTGTCTGGTGAAGCTGCATGG + Intergenic
950335173 3:12187568-12187590 GCTTCTGTGGTGGAGCAGCCAGG - Exonic
952502737 3:33979053-33979075 AACTCTCTGGTGGCTCTGCAGGG - Intergenic
959470537 3:106744525-106744547 TCTTCTATGGTCGAGCTGTAGGG + Intergenic
960966695 3:123110599-123110621 ACTGTTCAGGTGGAGCTGAAAGG + Intronic
962172202 3:133113574-133113596 ACTTGTCTTGTGGGGCTGGAAGG - Intronic
962983948 3:140517704-140517726 TCTGCTCTGGTGGAGGTGGAGGG + Intronic
963878726 3:150504200-150504222 TTTTCTCAGGTGGAGGTGCATGG - Intergenic
973720121 4:53715251-53715273 AATTCTTTGCTGGAGCTGCTAGG + Intronic
977544700 4:98363720-98363742 ACATCACTCTTGGAGCTGCATGG + Intronic
981713904 4:147733791-147733813 ACTTCTCTGGATGATCTCCAAGG + Intronic
981716037 4:147753189-147753211 ACTGCTGTGTTGGAGCTGGAAGG + Intronic
985728265 5:1526855-1526877 CCTTCTCTGCTGCAGCTGGAAGG + Intergenic
987123936 5:14793505-14793527 AGTTCTCTGGTGGAGCAGCAAGG + Intronic
988640869 5:33040012-33040034 ACTTATCTCCTGGGGCTGCAAGG + Intergenic
991061952 5:62385500-62385522 CCTCCTCTTGTAGAGCTGCACGG - Exonic
991214762 5:64149235-64149257 CCTTCTCTGGTGGAGGTGGCAGG + Intergenic
992366226 5:76092887-76092909 ACTCCACAGCTGGAGCTGCAAGG - Intronic
992426380 5:76662210-76662232 ACCTGTCTGCTGGAGCTCCAAGG - Intronic
993097195 5:83493323-83493345 AATTTTCTGGTGGAGCAGAATGG + Intronic
995236233 5:109832904-109832926 ACTTCTCAGATGGGGCGGCAGGG + Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997259265 5:132453590-132453612 GCTTCTCTTGAGGAGCTGAATGG - Intronic
997598040 5:135120331-135120353 ACTTCACTTGTGGAGTTGCAAGG + Intronic
998354939 5:141527144-141527166 ACTTTTATGGTTGATCTGCATGG + Intronic
998768877 5:145519085-145519107 ACTTCTCTGGTGGAGCTGCATGG + Intronic
999655779 5:153809245-153809267 ATTTCCCTGGTGTAGCTTCAAGG + Intronic
999720826 5:154398201-154398223 ACTCCTGCGGTGGAGCAGCAAGG + Intronic
1000264553 5:159622003-159622025 CCTTCTCTGGTGGAGGTGGCCGG - Intergenic
1005606070 6:27478618-27478640 ACCTCTCTGGGGCAGCCGCAAGG - Intergenic
1005763507 6:28988819-28988841 AGTTCTCTGATGGCGCTGGAGGG + Intergenic
1007740706 6:44008017-44008039 ACTTCCCTGCTGTAACTGCAGGG - Intergenic
1009267160 6:61569680-61569702 CCTGCTCTGGTGGAGGTGCTAGG - Intergenic
1010010780 6:71045551-71045573 ACTTCTCTGGCGGTCCTTCAGGG + Intergenic
1011878454 6:91992332-91992354 TCTTCTGTGGTCGAGCTGTAGGG - Intergenic
1013204554 6:107934476-107934498 ACTTCTCAGATGGAGCGGCCGGG - Intronic
1013483134 6:110569199-110569221 ACTACTCTTGTGGTGCTGAAGGG + Intergenic
1017773101 6:157658369-157658391 AATCTCCTGGTGGAGCTGCAAGG - Intronic
1021050194 7:15973602-15973624 ACTTCTCTGAGTCAGCTGCAGGG + Intergenic
1023870244 7:44259329-44259351 TCTCCTCATGTGGAGCTGCACGG - Intronic
1024118317 7:46213320-46213342 ACTTCTCATGTGGCCCTGCATGG - Intergenic
1028262889 7:88686423-88686445 GCACCTCTGGGGGAGCTGCAAGG - Intergenic
1029267798 7:99355915-99355937 ACTTCTCTGCTGTGGCTGGAAGG + Intronic
1030601416 7:111597220-111597242 TCTTCTGTGGTCGAGCTGTAGGG + Intergenic
1030804831 7:113903249-113903271 ACTACTCTGGTGGTGCTTAAGGG - Intronic
1031838232 7:126704673-126704695 TCTTCTATGGTCGAGCTGTAGGG + Intronic
1032693956 7:134317052-134317074 TCCTCTCTGGCGGAGCTGCCTGG - Intergenic
1035285572 7:157804465-157804487 CATTCTCTGGAGCAGCTGCATGG - Intronic
1037835657 8:22213482-22213504 TCTACACTGGTGGAGCTGCCTGG + Intergenic
1038776092 8:30532002-30532024 ATTTCCCTGGTGAAGCTGGAGGG + Intronic
1038786572 8:30622659-30622681 TCTTCTATGGTCGAGCTGTAGGG - Intronic
1042102325 8:65286706-65286728 ACTTCCCTTGTGGAAGTGCATGG - Intergenic
1042497471 8:69471214-69471236 ACTTCTCAGGTGGAGTGACAGGG + Intronic
1044498971 8:92928729-92928751 GCCTCTCTGGTGGACCAGCAAGG + Intronic
1049113810 8:140668286-140668308 ACTCCTCTGGTGGGGCTGGCTGG + Exonic
1055554776 9:77462936-77462958 ACTCCTCTGCTGGAGAGGCACGG - Intronic
1057631177 9:96720073-96720095 TTTTCTCTGGTTGGGCTGCAGGG - Intergenic
1060107959 9:120886146-120886168 ACATCTGGGCTGGAGCTGCACGG + Intronic
1185587127 X:1248524-1248546 ACTTTTCTTGTGGAGGTGGAGGG + Intergenic
1187163599 X:16785830-16785852 ACAACTCTGGTGGAGGGGCAGGG + Intergenic
1188252571 X:27915787-27915809 AGTTCTCTCGTGGAGATGCGTGG - Intergenic
1188763443 X:34059886-34059908 AATTAGCTGGTGGTGCTGCATGG - Intergenic
1190116666 X:47629858-47629880 TCCTCTCTGGTAGAGGTGCAGGG - Exonic
1191980852 X:66923937-66923959 TCTTCTATGGTCGAGCTGTAGGG + Intergenic
1192203399 X:69081310-69081332 GCTTCCCTGGGGGAGCTGCAGGG - Intergenic
1202331158 Y:23754517-23754539 AATTCTTTGAAGGAGCTGCAAGG - Intergenic
1202539611 Y:25915543-25915565 AATTCTTTGAAGGAGCTGCAAGG + Intergenic