ID: 998770319

View in Genome Browser
Species Human (GRCh38)
Location 5:145536551-145536573
Sequence TTCCTATGTGGAGGGAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998770314_998770319 18 Left 998770314 5:145536510-145536532 CCATGATCTTGCAAAATGTTCTA 0: 1
1: 0
2: 0
3: 19
4: 199
Right 998770319 5:145536551-145536573 TTCCTATGTGGAGGGAAAGCTGG 0: 1
1: 0
2: 3
3: 25
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998770319 Original CRISPR TTCCTATGTGGAGGGAAAGC TGG Intronic
901017314 1:6239333-6239355 TTCCTCTGTGGCGGGAAAGCAGG - Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902726916 1:18342829-18342851 TTCCTCAGTGGATGGAAATCTGG + Intronic
902782299 1:18712459-18712481 TTCCTGGGTGGAGGGAAATGAGG + Intronic
903042636 1:20542820-20542842 TTCTGATGTGGAGGGCAAGGTGG - Intergenic
904769890 1:32875131-32875153 TGTTTCTGTGGAGGGAAAGCAGG + Intergenic
904920918 1:34007286-34007308 GTCCTCTGTGGATGGGAAGCAGG + Intronic
905210810 1:36372933-36372955 TGCCTTTGTGGATGGAGAGCAGG - Intronic
909530448 1:76675890-76675912 TTCCTAGGTTCAAGGAAAGCAGG - Intergenic
910116806 1:83740203-83740225 TGGCAATGTGGAGGGACAGCCGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
911388026 1:97202360-97202382 TTCCTAATTGGAGGAAAAGGGGG - Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
913206359 1:116542782-116542804 TTCATATCAGGAGAGAAAGCAGG + Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
918453285 1:184681569-184681591 TTCCTGTGTTGAGGGAAGTCAGG - Intergenic
919164184 1:193871343-193871365 TTCATATGTTCTGGGAAAGCTGG + Intergenic
919925522 1:202189955-202189977 CTCCTATGTGGAGGGGAGGAAGG - Intergenic
921621182 1:217328176-217328198 TTCCTGGGTGGAGGCAAAGCAGG + Intergenic
923019272 1:230150260-230150282 TTCCTATGGTGAGGTAAAGAGGG - Intronic
923234392 1:232018731-232018753 TACCCGTGTGGAGGGACAGCAGG + Intronic
1066307008 10:34155167-34155189 AGCCTATGTGAAGGGAAGGCAGG + Intronic
1067702941 10:48586904-48586926 CTCCTATGGAGAGGGAAAGGGGG - Intronic
1068942115 10:62690420-62690442 TTCCTTTGTTCAGGGCAAGCAGG - Intergenic
1070181548 10:74018800-74018822 TTCCTATGAGGAGGGAAACTGGG - Intronic
1070453464 10:76585174-76585196 TTCCTCTGTGGAGGGATATTGGG - Intergenic
1072766027 10:98095912-98095934 TTTCTCTGAGGAGGGATAGCAGG + Intergenic
1074065100 10:110007291-110007313 CCCCTATGTGGAGGTGAAGCAGG + Intronic
1074669038 10:115766650-115766672 TTCCACTGTAGAGGGAAGGCGGG + Intronic
1076081594 10:127586569-127586591 TTCCTTTCAGGAGTGAAAGCAGG - Intergenic
1077554776 11:3220700-3220722 TTCCTTTGGGAAGGGAAGGCAGG - Intergenic
1078862275 11:15260222-15260244 ATCCTGTGTCCAGGGAAAGCAGG - Intergenic
1079205899 11:18414044-18414066 TTTCTATGTGGTGGTAAAGATGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082567717 11:54700533-54700555 TTTCTAGGTGGAGGGCAAGTAGG + Intergenic
1082770143 11:57201573-57201595 ATTCCAGGTGGAGGGAAAGCAGG + Intergenic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1085036612 11:73304457-73304479 TTTCTGTGTGGTGGGACAGCAGG + Intergenic
1085061189 11:73448592-73448614 TTCCTAAGTGCTAGGAAAGCTGG - Intronic
1086609298 11:88735446-88735468 TTGCTATGTGGAGAGAAAGTTGG - Intronic
1087143938 11:94793374-94793396 TTCCAATGTGGAGCGAAACTGGG - Intronic
1091784648 12:3235813-3235835 TGCCTGTGTGGGGGGACAGCAGG + Intronic
1095235771 12:39793743-39793765 TTCCTATGAAGAGGAAAAGCAGG - Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098222029 12:68280416-68280438 TTCATATTTGAAGGGAAGGCAGG + Intronic
1103798162 12:123519522-123519544 TTCCTATGTGGGGGGTGAGGGGG - Intronic
1105003779 12:132708506-132708528 TGCCTATGTGGAAGGAAACCAGG - Intergenic
1106238003 13:27881648-27881670 TTCCTCTATGGAGGGAAAGTGGG - Intergenic
1106673573 13:31933543-31933565 ATTCTATGTGCAGGGAAAGGGGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1109221045 13:59641383-59641405 TGCCTATGTGGAGAGCAAGGAGG - Intergenic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1110491346 13:76112268-76112290 TCCCAATATGGTGGGAAAGCTGG - Intergenic
1110740818 13:78994126-78994148 TTCTTATGTAGATGCAAAGCAGG + Intergenic
1111330969 13:86761801-86761823 TTAATATTTGGAAGGAAAGCAGG + Intergenic
1113233954 13:108248400-108248422 TTCCTCTGTGGAGGGAGGGAGGG + Intergenic
1113269977 13:108662648-108662670 TTCCCAGGTGGAGGGCAAGATGG + Intronic
1113443639 13:110348767-110348789 TTCCTCTGTGGAGGGAATTTGGG + Intronic
1113600795 13:111566819-111566841 ATTCTATGTGGAGGGAACGCCGG - Intergenic
1113762788 13:112861473-112861495 TACGTAAGTGCAGGGAAAGCTGG - Intronic
1114135512 14:19844533-19844555 TTCCCATGTGGAGGAAAATCTGG - Intergenic
1114453016 14:22838635-22838657 GGCCAATGTGGAGGGAAAGCTGG + Intronic
1116639260 14:47440211-47440233 TTCCTGTGTGCAGGCAAAGCAGG - Intronic
1117251105 14:53939146-53939168 TTGCACTGTGGAGGGAAAACTGG - Intergenic
1117339443 14:54781058-54781080 TTGCTAGGAGGAGAGAAAGCAGG - Intronic
1118245900 14:64110414-64110436 TTCCAAAGTGTAGTGAAAGCAGG + Intronic
1118317157 14:64732361-64732383 GTCCTATGGGCAGGGAAGGCCGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120513233 14:85440460-85440482 TTCCAATGGGGAGGGAGGGCAGG + Intergenic
1120868623 14:89317698-89317720 TTTCTATGGGGGGGGAAAGGAGG - Intronic
1123438461 15:20272743-20272765 TTCCTAGGGGCAGGGACAGCAGG + Intergenic
1124787276 15:32693345-32693367 TTCCTATGTGGAGGAAATTGAGG - Intronic
1127210439 15:56769103-56769125 TGCCTGTGAGGAGGGAAAGTAGG + Intronic
1128036868 15:64534637-64534659 TTCACATGTGCAGGGAAAGTGGG - Intronic
1128323332 15:66707153-66707175 TGCCTATGTGGACGGAAATGTGG + Intronic
1128593830 15:68927259-68927281 CTCCTAAGTGAAGGGAAAGCAGG + Intronic
1129203295 15:74019131-74019153 TTTCCATCTAGAGGGAAAGCAGG + Intronic
1129413921 15:75364328-75364350 TTCCTATGTGAAGGGGAGGAGGG - Intronic
1129701998 15:77773567-77773589 TTCCTGTGTGGAGAGGGAGCTGG - Intronic
1129809662 15:78498747-78498769 TTCATATGTGGAGGGAACCTTGG - Exonic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1131856063 15:96596214-96596236 TTCCTACATAGAGAGAAAGCAGG - Intergenic
1134243746 16:12524485-12524507 TTATTAAGTGGAGGAAAAGCAGG - Intronic
1134803243 16:17104713-17104735 TTCCAATTTGGAAGGGAAGCCGG - Exonic
1134805353 16:17119506-17119528 TTCCTATGTGCAGGGGAAATAGG + Intronic
1135605654 16:23822085-23822107 AGCCTCTGTGGAGGGCAAGCTGG + Intergenic
1138452000 16:57098544-57098566 TTCCTGTGTGGCTGGAAAGTGGG + Intronic
1140619775 16:76716338-76716360 TTTCTAGGTGGAGGGTCAGCTGG - Intergenic
1141170590 16:81688235-81688257 TTCCTGTGTGCAGAGACAGCGGG - Intronic
1141277169 16:82598845-82598867 GTACTATGTGGAGGGCAAGATGG + Intergenic
1141866102 16:86751089-86751111 TTCCTTTCTGGAGGGCAACCCGG - Intergenic
1142354086 16:89593876-89593898 TTCCTGTGTGGCTGGGAAGCGGG + Intronic
1143634957 17:8159325-8159347 TTTCTGTGTGGAGGGGGAGCAGG - Exonic
1143670758 17:8394125-8394147 TGACTATGTGGAGGGCCAGCAGG - Intronic
1143884245 17:10054233-10054255 TTCTTATGGTTAGGGAAAGCAGG - Intronic
1145233448 17:21191712-21191734 TTCCTATGAGGTGCTAAAGCAGG - Exonic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145875294 17:28314751-28314773 TTCCTAAGGGAAGGGGAAGCTGG + Intergenic
1145982177 17:29019485-29019507 TGCCTCTGGGGAGGGGAAGCTGG - Intronic
1146549787 17:33770323-33770345 TTCCTCTGTAAAGCGAAAGCTGG + Intronic
1147991074 17:44333844-44333866 TGACTGTGTGGAGGGCAAGCGGG + Intergenic
1148027812 17:44600450-44600472 TTCCTATGTGGAGGAAAGCGGGG - Intergenic
1148398016 17:47325380-47325402 TTACTGTGAGGAGGGAAATCAGG - Intronic
1154276262 18:12963526-12963548 TTCCTCTGTTGAGTGAAAACAGG - Intronic
1154304794 18:13222805-13222827 TTCCTCTGAGCAGGGAAATCAGG + Intronic
1154459618 18:14568028-14568050 TTCCCATGTGGAGGAAAATCTGG - Intergenic
1155046936 18:22110815-22110837 TTCCCCTGTGGAGGGAACTCAGG - Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155922294 18:31615446-31615468 CACCTCTGTGGAGGGAAAGTTGG - Intergenic
1156363771 18:36407146-36407168 TTCCTATGTGGTGGGGAAAGGGG - Intronic
1157698653 18:49745320-49745342 CTGCTGTGTGGAGGGAAGGCAGG + Intergenic
1158414924 18:57241890-57241912 CTCCTATGAGGAGGGAGAGCAGG + Intergenic
1160585418 18:79911124-79911146 TTGCTGTCTGGAGGGAAATCGGG + Intronic
1160685103 19:430943-430965 TTCCGAGGTGGAGAGAAGGCGGG - Intronic
1162909171 19:13840268-13840290 TACCTATGTGGGGAGAAGGCAGG - Intergenic
1163223978 19:15942144-15942166 TTCCTAATTGGAGAGAAGGCAGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164288006 19:23839481-23839503 TTTCCATGTGGAGGGCAAGTTGG + Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164466279 19:28489953-28489975 TTCCTTTGTGGCAGGAAGGCTGG + Intergenic
1165524558 19:36342739-36342761 TTCCTCTGGGGAGGGAGACCTGG + Intronic
1166733852 19:45073134-45073156 TTCCTGTCCTGAGGGAAAGCCGG - Intronic
1168142880 19:54401017-54401039 TTCCTCTGTGGAGGGAAAGGTGG - Intergenic
925917557 2:8617570-8617592 TTCCTAACTGGTGGGATAGCAGG - Intergenic
926165390 2:10519632-10519654 TTCCAATCTGATGGGAAAGCGGG - Intergenic
926383027 2:12310063-12310085 TTCCTGTATGGAATGAAAGCTGG - Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
928229861 2:29488812-29488834 TTCCTAGGTGGAGGAAGACCGGG - Intronic
929644411 2:43612519-43612541 TTCCAATCTATAGGGAAAGCAGG - Intergenic
930438738 2:51379654-51379676 TTCCTACTTGGAAGGAAAGCAGG + Intergenic
934952300 2:98585184-98585206 TCACTTTGTGGAGGGAAAACAGG - Intronic
936164412 2:110107307-110107329 TTTCTAGGTGGAGGGCAAGATGG - Intronic
936759938 2:115765325-115765347 TTGCTATGTGGGGGTAAATCTGG + Intronic
937528154 2:122796215-122796237 TTCCTGTGGGGAGGTCAAGCAGG + Intergenic
937857939 2:126686217-126686239 TTCAGATGTGGACGGAGAGCAGG - Intronic
937920802 2:127128704-127128726 TGCCAGTGTGGAGGCAAAGCAGG + Intergenic
938969701 2:136421005-136421027 TTCCTCTGTGTTGGGAAACCAGG + Intergenic
939179339 2:138785646-138785668 TTCATATATGGAGCGAAAGCAGG + Intergenic
940366834 2:152857719-152857741 TATCTGTGTGGAGGGAAAGGAGG + Intergenic
947229795 2:227873132-227873154 TTCCTAGCTCTAGGGAAAGCTGG - Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1169529262 20:6466578-6466600 GTCCTAAGTGAAGGGAAAACAGG + Intergenic
1169750462 20:8987538-8987560 AACCAATGTGGAGGGGAAGCTGG - Intergenic
1170139875 20:13114850-13114872 TTTATATGTGGAGGGAAAAGTGG + Intronic
1170427433 20:16248827-16248849 TTGCTATGTGGAGGAAAACCAGG - Intergenic
1172984793 20:38976043-38976065 TTACTAAGTCCAGGGAAAGCTGG + Intronic
1175544021 20:59766490-59766512 TTGATAGGTTGAGGGAAAGCTGG + Intronic
1176814508 21:13584804-13584826 TTCCCATGTGGAGGAAAATCTGG + Intergenic
1178068785 21:28937244-28937266 CTACTTTATGGAGGGAAAGCAGG - Intronic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1179362772 21:40727953-40727975 ATCCCAGGTGGAGGGAGAGCAGG - Intronic
1179776915 21:43670567-43670589 TGCCTCTGTAGAGGGAGAGCAGG + Intronic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181362330 22:22347454-22347476 GTCTAATGTGGGGGGAAAGCAGG - Intergenic
1181406647 22:22689726-22689748 CTCCTATGTGCAGAGACAGCTGG + Intergenic
1181683862 22:24515206-24515228 TTACTACATGGAGGGAAACCTGG + Exonic
1181961980 22:26628757-26628779 TTCCTGTGTGAAGGCAAAGGTGG + Intronic
949134106 3:541648-541670 TTAATTTGTGGAGGGAATGCAGG - Intergenic
949576170 3:5340963-5340985 GAGCTATGTGGAAGGAAAGCAGG - Intergenic
951555107 3:23913433-23913455 TTCCTATTTGGAAGGCAACCAGG - Intronic
951900160 3:27649454-27649476 GTCCTTTGTGGAGAAAAAGCTGG + Intergenic
952424298 3:33159148-33159170 GTCCTAGGTGATGGGAAAGCTGG + Intronic
952495143 3:33909246-33909268 TTCCTATAAGGAGGGACAGGAGG + Intergenic
952822009 3:37493959-37493981 TTGCTGTGTGGAAGGAAAGGGGG - Intronic
952932184 3:38368975-38368997 TGCCAGTGAGGAGGGAAAGCTGG + Intronic
953930621 3:47004057-47004079 TGCCTATGGGGAGGAACAGCAGG - Exonic
954043338 3:47907303-47907325 TTGCTCTGGAGAGGGAAAGCTGG + Intronic
954670870 3:52290749-52290771 TATCTATCTGGAGGGAAACCTGG + Intronic
954794463 3:53154521-53154543 TACCTCTCTGGAGGGAGAGCTGG - Intergenic
956286066 3:67611939-67611961 TTCCTTTGTGGAGTGATAGCCGG - Intronic
956503512 3:69912262-69912284 TGCCTCTGGGGAGGGAGAGCAGG + Intronic
957938731 3:86977435-86977457 TTCCTATCATGAGGAAAAGCTGG - Intronic
958798889 3:98733520-98733542 TTCCATTGTGGAGGGAAAAAGGG - Intronic
959571855 3:107893311-107893333 TTCCTATCTGGAGCCAAGGCGGG - Intergenic
960398341 3:117165266-117165288 TTCCTAAGAGGAGAGAAATCTGG + Intergenic
961406630 3:126684322-126684344 TTCCTGGATGGAGGGAGAGCAGG + Intergenic
961589004 3:127961209-127961231 TTCCTATTTGTAGGGCAAGAAGG - Intronic
965680648 3:171247900-171247922 TGACTATGTGGAGGCAAAGAGGG + Intronic
965774589 3:172215382-172215404 TTCCTAAGAGCAGAGAAAGCTGG + Intronic
966187027 3:177236612-177236634 TTAAAATGTGCAGGGAAAGCTGG - Intergenic
966559002 3:181297858-181297880 TGCCTGTGTGGAGGGAGGGCAGG - Intergenic
966571932 3:181453642-181453664 TTCCAAGGTGGTGGGGAAGCTGG - Intergenic
966949178 3:184800708-184800730 TTCTGATGGGAAGGGAAAGCGGG - Intergenic
967305393 3:188054008-188054030 TCCCTATGTGGACGGAGAACAGG - Intergenic
967759753 3:193210157-193210179 TTCCTGTGTGGTGGGATAGGAGG + Intergenic
967817395 3:193810984-193811006 TTCCTCTGTAGAGGCAAATCAGG - Intergenic
968554380 4:1239783-1239805 TTCCTATCTTGAAGGAAAGTGGG - Intronic
971036035 4:22693740-22693762 TCCCTTTGTGGAGGGGAAGGGGG - Intergenic
973653424 4:53020677-53020699 TTCCTATTTGCAGGGGAGGCTGG - Intronic
976916064 4:90375949-90375971 TCCCCATGTGGAGGTCAAGCTGG - Intronic
977919031 4:102623904-102623926 TTCATTTGTTGAGGGAATGCTGG - Intergenic
979911831 4:126377090-126377112 TTTCTATGTAGAAGTAAAGCAGG - Intergenic
981977391 4:150747271-150747293 TACTTCTGTGGAGGGAAAGCAGG - Intronic
982161816 4:152578072-152578094 TTCCTATGTAGAGAGAGAGAGGG - Intergenic
986470405 5:8068048-8068070 TTTCTCAGTGGAAGGAAAGCAGG + Intergenic
986640175 5:9864271-9864293 TTCCTATCGGGTGGGAAAGTTGG - Intergenic
986807856 5:11325840-11325862 CTCCTATGTTGAAGGAATGCTGG - Intronic
989103843 5:37842556-37842578 ATCCTCTGTGGAGGGAATGTGGG - Intergenic
990613831 5:57487020-57487042 TTGCCCTGTGGAGTGAAAGCTGG - Intergenic
991456251 5:66807661-66807683 TTCCTCTATGCAGGGAAAGTGGG - Intronic
994727371 5:103452525-103452547 TTCCTACCTGGAGGGAAAAAGGG - Intergenic
995478950 5:112576347-112576369 GGCCTATTTGGAAGGAAAGCAGG + Intergenic
996851663 5:127959897-127959919 TTCCTATGTGGTGTGCAAACAGG + Intergenic
997008271 5:129846619-129846641 TTCCTTTTTGGGGGGAAGGCAGG - Intergenic
997982213 5:138475425-138475447 TTCCCCTGTGGAGGGACATCTGG + Intergenic
998770319 5:145536551-145536573 TTCCTATGTGGAGGGAAAGCTGG + Intronic
999722693 5:154410712-154410734 TTCCGGTTTGAAGGGAAAGCAGG + Intronic
1003102292 6:3186116-3186138 TGCCTGTGTGGAGGGCAGGCTGG + Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003614319 6:7641591-7641613 TTCCTATCAGTTGGGAAAGCTGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007409125 6:41651670-41651692 TTCCTGTGTGGAGGGAACTAGGG - Intronic
1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG + Exonic
1007966005 6:46004333-46004355 TTCCTCTGTGCAAGGGAAGCTGG - Intronic
1008687463 6:53941514-53941536 TATCTATGTAGAAGGAAAGCAGG + Intronic
1010571768 6:77482066-77482088 TAACTATGTGGAAGGAAGGCTGG - Intergenic
1013541935 6:111119149-111119171 ATCCTATTTGGAGGTAAACCGGG + Intronic
1013833118 6:114298620-114298642 GTCCTATGTTGCGGGAAGGCAGG + Intronic
1015014540 6:128395784-128395806 TTCCTTTGCAGAGGGAAAACTGG - Intronic
1015101873 6:129491057-129491079 TTCATATCTGGAGAGAAAACCGG - Intronic
1017054706 6:150426388-150426410 TTCCTATCTGGAGCAAAAGTTGG - Intergenic
1017517784 6:155173006-155173028 TGCCCATTTGGAGGGAAAGTTGG - Intronic
1019978350 7:4602820-4602842 TTCCCATCAGGAGGGAGAGCAGG - Intergenic
1020011823 7:4809410-4809432 TTCCTGTGTGCACGGAAAGGAGG - Intronic
1021298323 7:18937815-18937837 TTCCTATGTGGAAGGAAATCAGG + Intronic
1022403252 7:30061881-30061903 TTACTTTCTGGAGGGAAAGCAGG - Exonic
1022414555 7:30166916-30166938 TTCCTATGGGAAAGAAAAGCTGG + Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1024982751 7:55171408-55171430 GTCCTCAGTGGAGGGAAAGTTGG + Intronic
1026323937 7:69292624-69292646 TTCTGATCTAGAGGGAAAGCAGG + Intergenic
1029529763 7:101117509-101117531 CTCCCATATGGAGGGGAAGCTGG + Intergenic
1033512725 7:142076151-142076173 TTCTTCTGTGGTGGGCAAGCCGG + Intronic
1033681516 7:143600391-143600413 TTCATCTGTGGTGGGAAGGCTGG + Intergenic
1033703376 7:143861422-143861444 TTCATCTGTGGTGGGAAGGCTGG - Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034272678 7:149811056-149811078 TGCCTCTGAGGAGGGACAGCAGG - Intergenic
1034987857 7:155528465-155528487 TGCCAATGTGGAGGCCAAGCTGG + Intronic
1035327520 7:158074622-158074644 TCCCGAGGTGGAGGGGAAGCTGG + Intronic
1036802707 8:11804330-11804352 TTCCTGTTGGGAGGGAAAGTGGG + Intronic
1038837280 8:31140407-31140429 TTTCTATATGAAGTGAAAGCAGG + Intronic
1040381314 8:46876082-46876104 TTAATATGTGGATGGAAAACAGG + Intergenic
1042403232 8:68373384-68373406 TTCCTATGAGTAGAGAGAGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044618447 8:94165974-94165996 TACCTATGAGGAAGGAAAGAAGG + Exonic
1045327518 8:101127708-101127730 TTCCTATGAGAGGGGAAAGGAGG - Intergenic
1045583562 8:103503959-103503981 TTCCTATGTGGATGTTCAGCTGG - Intronic
1046178782 8:110614668-110614690 TTCTTATCTGGAGGGAAATAGGG + Intergenic
1048056277 8:130869219-130869241 TTGTTATCTGGAGGGAAACCAGG + Intronic
1048974164 8:139661916-139661938 TTCCTGTGGGGAGGGACTGCTGG + Intronic
1049271618 8:141699100-141699122 TCGCCATGTGGAGGGGAAGCTGG - Intergenic
1049524110 8:143112258-143112280 TCCATTTGTGGAGGGAACGCAGG + Intergenic
1049544608 8:143224192-143224214 TCCATTTGTGGAGGGAACGCAGG - Intergenic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1053908768 9:42873625-42873647 TTCCTTTTTTGAGGGGAAGCTGG + Intergenic
1058923342 9:109639228-109639250 TTTCTCTGTGAAGGGAAACCTGG + Intergenic
1059634733 9:116159742-116159764 TTCCTCTGTGCAGGGAAAAATGG - Intronic
1061067127 9:128285512-128285534 TTTCAGTGTGTAGGGAAAGCTGG + Intronic
1061639070 9:131937107-131937129 TTCCTACCTGGAGGGGGAGCAGG - Intronic
1061756631 9:132817370-132817392 CTCCTATGAGGAGAGAAAACAGG + Intronic
1185850166 X:3477783-3477805 TTCTCATGTGGATGGAAATCTGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1190307732 X:49095107-49095129 TCCCTTTGCAGAGGGAAAGCTGG - Intronic
1190497236 X:51038285-51038307 TTCCTATGTGGATGAAGAACAGG + Intergenic
1190968659 X:55328000-55328022 TTCTTATCTGGAGGCAAGGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1199565697 X:149213385-149213407 GCCCTGTGTGGAGGGCAAGCAGG - Intergenic
1199904139 X:152207112-152207134 TTCTGAGGTGGAGGGAAAACAGG + Intronic
1200082762 X:153587172-153587194 TGCTTATGTGGAGGGAGAGATGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200812169 Y:7497706-7497728 TTCTCATGTGGATGGAAATCTGG - Intergenic