ID: 998772154

View in Genome Browser
Species Human (GRCh38)
Location 5:145557949-145557971
Sequence CTGTGAGAACAAAAGTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 400}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998772153_998772154 9 Left 998772153 5:145557917-145557939 CCTTGGCTACAAAACGAGATCAG 0: 1
1: 0
2: 1
3: 5
4: 107
Right 998772154 5:145557949-145557971 CTGTGAGAACAAAAGTAAGATGG 0: 1
1: 0
2: 1
3: 34
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998772154 Original CRISPR CTGTGAGAACAAAAGTAAGA TGG Intronic
902989320 1:20175156-20175178 CGATGAGAAAAAAAGGAAGAAGG + Exonic
903331541 1:22599555-22599577 CTGTGACAACAAAAGAAAGAAGG + Intronic
903912996 1:26742226-26742248 CTGGGAAAACAGAAGTAAAATGG - Intronic
907696784 1:56738942-56738964 CTTTGAGAACAAAAGAAGGCTGG + Intronic
908108027 1:60865843-60865865 CCCTGAAAACAAAAGTAAGGGGG - Intronic
908448450 1:64225304-64225326 CTGTGAGAGAATCAGTAAGAAGG + Intronic
909379193 1:74977987-74978009 TTGTGAGGCCAAAATTAAGAGGG + Intergenic
909840624 1:80317680-80317702 CTGTAAAAAGAAAATTAAGATGG + Intergenic
910045166 1:82904602-82904624 CTGTGAAAAAAAGAGTTAGAGGG + Intergenic
910836055 1:91512064-91512086 CCGTAAAAACAAAAATAAGATGG - Intronic
911574315 1:99556918-99556940 CTCTGAGAATACAAGTAATAAGG + Intergenic
911723592 1:101218235-101218257 CTGGGAGGATAAAATTAAGATGG + Intergenic
911809711 1:102260447-102260469 CTGTGAGAACCTAAGTAAGCCGG - Intergenic
913995414 1:143648451-143648473 CAGCGAAAACAAAAGTGAGATGG + Intergenic
914360857 1:146934741-146934763 CAGCGAAAACAAAAGTGAGATGG - Intergenic
914440207 1:147698976-147698998 TTGTGAGGACAAAAGTGAGCAGG + Intergenic
914491728 1:148155896-148155918 CAGCGAAAACAAAAGTGAGATGG + Intergenic
915820209 1:159015165-159015187 GTGAAAGAACAAAAGTGAGAGGG + Intronic
916895892 1:169161625-169161647 CTGTGAGGCCAGAAGCAAGATGG - Intronic
917450298 1:175142394-175142416 CTGTGAACACAAAAATAAGAAGG - Intronic
917567457 1:176227648-176227670 CGGTCAGAACAAGAGAAAGATGG + Intergenic
918025873 1:180745510-180745532 CAGTGAGAACAGTAGTAACAGGG - Intronic
920120932 1:203657679-203657701 CCATGAGAAGAAAAGAAAGAAGG - Intronic
921049640 1:211501872-211501894 CTGTGAGAAGAGAAATAACACGG - Intergenic
921100842 1:211928240-211928262 CTGTAAGAAAAAAAGAATGATGG - Intergenic
921134822 1:212250624-212250646 CTGTGAGACAAAGAGAAAGATGG - Intergenic
921378217 1:214496119-214496141 CTGTGAGCACAAAACTGAAATGG - Intronic
921441649 1:215193945-215193967 CTGGAAGAAGGAAAGTAAGAAGG - Intronic
921684753 1:218076991-218077013 CAGTGAGAACAGATATAAGAAGG - Intergenic
921755497 1:218851098-218851120 TTCTGAGAAAAAAATTAAGAAGG + Intergenic
923229505 1:231971586-231971608 CTGTGAGAACATTAGTTACAAGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
924871414 1:248050332-248050354 CTGTTAATACAAAAGTAAAAGGG + Intronic
1063665970 10:8060890-8060912 CTGTGAGAAAGGAATTAAGAAGG - Intronic
1065509830 10:26467223-26467245 CTTTGAGAATAGAAGTATGAGGG + Intronic
1065580875 10:27170576-27170598 CTGTGAAAAGAATAGTAAGAGGG + Exonic
1068439522 10:57032888-57032910 CTGTAAAATCAAAAGCAAGATGG - Intergenic
1068972058 10:62969447-62969469 CTGTAAGAATGAAAGAAAGATGG + Intergenic
1069190408 10:65480192-65480214 AAGAAAGAACAAAAGTAAGAAGG + Intergenic
1069314866 10:67085387-67085409 CTGTGAAAAAAAAAATGAGAGGG + Intronic
1073438987 10:103541298-103541320 CTGTGTGAAGAAAAATAAGGAGG + Intronic
1073633523 10:105173778-105173800 CTGTGAGAAGAACAGAAAGATGG - Intronic
1074005436 10:109418174-109418196 TTGTGAGAAAAAAAGTCAAACGG - Intergenic
1074936813 10:118190157-118190179 GTGGGAGAGAAAAAGTAAGAAGG + Intergenic
1075936695 10:126348494-126348516 ATGTGGGAACAAATGCAAGAGGG + Intronic
1076136610 10:128049507-128049529 CTGTGGGATCAAAAGAAACATGG - Intronic
1077547405 11:3180833-3180855 TTGTGAGAAACACAGTAAGAAGG + Intergenic
1077934964 11:6773866-6773888 TTGTGAGGTCAGAAGTAAGATGG + Intergenic
1078511341 11:11986400-11986422 TGGTGAGAACAAAAGAAAGTAGG + Intronic
1080875192 11:36268459-36268481 ATGTGAGCACCAAAGAAAGAAGG + Intergenic
1081123733 11:39297147-39297169 CAGTGAAAACAATAGTAAAAGGG + Intergenic
1081142020 11:39513244-39513266 TTGTGAGAACACAAGAAAGAAGG - Intergenic
1082037187 11:47654472-47654494 CTCTAAGAACAAAGGAAAGAGGG + Intergenic
1083438297 11:62658516-62658538 CAGAGAGAACAAAACTATGAAGG + Intronic
1085621637 11:78042125-78042147 CTGTGACACCAGAAGCAAGATGG - Intronic
1086848245 11:91778378-91778400 CTGAGTGAACAAAAGTATTAAGG - Intergenic
1087426007 11:97986976-97986998 CTGTGAGAATAAAAATTAGATGG - Intergenic
1087452400 11:98341978-98342000 GTGGGAGAGGAAAAGTAAGAGGG - Intergenic
1087670215 11:101097665-101097687 CTGTAAGAAAAAAAGTTAAAAGG - Intronic
1088364170 11:109021417-109021439 ATGTGAGGACAACAGCAAGAAGG - Intergenic
1088376089 11:109143187-109143209 GTATGAGAATTAAAGTAAGAAGG + Intergenic
1089405250 11:118192264-118192286 CTGTGAAATCAAAAGCAAGCTGG - Intergenic
1090288340 11:125519675-125519697 CTGTGAGGCTAAAAGCAAGATGG - Intergenic
1091333769 11:134751593-134751615 TTGTGAGATCAGAAGCAAGATGG - Intergenic
1092268133 12:6999391-6999413 CTGTGAGAAAGAAAGAAAAAGGG + Intronic
1092607971 12:10140661-10140683 CTGTTAGCACTAAAGAAAGAAGG + Intergenic
1092937539 12:13378050-13378072 CTCTGAGAACAATGGTAACATGG + Intronic
1093221978 12:16432613-16432635 GTGTGACAATAAAAGCAAGAGGG - Intronic
1093770024 12:23007325-23007347 GTGGGAGAAAAAAAGAAAGATGG + Intergenic
1095349830 12:41196210-41196232 CTGTAAGATAAAAAGTAAGGAGG + Intronic
1097866150 12:64560663-64560685 CTGAGAAAACAAGAGTAAGATGG - Intergenic
1098056832 12:66516016-66516038 CTTGGAGTACAAAAGTAAGAAGG + Intronic
1098077965 12:66753660-66753682 CTCTGGGAACAAAATGAAGAGGG - Intronic
1098289606 12:68945335-68945357 CTGTGAGACTAGAAGCAAGATGG + Intronic
1098577507 12:72059951-72059973 CTGATAGAACAACTGTAAGAGGG + Intronic
1098904448 12:76147593-76147615 TTGTGAGAACAAATGGAAGAAGG - Intergenic
1098921392 12:76305426-76305448 CTGTGAGGCTAAAAGCAAGATGG - Intergenic
1099011768 12:77299709-77299731 CTCTGAGAATAAAACTAAAAAGG + Intergenic
1099504563 12:83457013-83457035 TTGTCAGAACAAAGGTGAGATGG - Intergenic
1099755204 12:86837393-86837415 CTATTAGAACAAAGGAAAGAGGG - Intronic
1099981210 12:89605443-89605465 AAGTGAGCACAAAAGCAAGAGGG - Intronic
1099986028 12:89665409-89665431 CTGGGAGAGCAAAAGAAAGTAGG - Intronic
1100365386 12:93915681-93915703 CTCTGAGAACACATCTAAGAAGG - Intergenic
1100366559 12:93926437-93926459 CTGTAAGAATTAAAGAAAGAGGG - Intergenic
1100594769 12:96062427-96062449 CTGTGAGAATAACAGTGGGAAGG - Intergenic
1101537850 12:105636120-105636142 CTGGGAGAAAATACGTAAGATGG - Intergenic
1101722105 12:107359184-107359206 CTGTGAGGACAAAAGGTAGGAGG + Intronic
1102252949 12:111399889-111399911 CTGTCAGAAAGAAAGAAAGAAGG + Intergenic
1103275003 12:119704136-119704158 ATGTGAGAAGAAAAGCAGGAGGG + Intronic
1103533266 12:121617332-121617354 CTGTGAAAAAAAAAGAAGGAAGG + Intergenic
1103768382 12:123299886-123299908 CTGTGAAAAGAAAAGAAGGAGGG + Intronic
1104752199 12:131246815-131246837 CTGTGAGCACAGAAGTGGGAAGG - Intergenic
1105057575 12:133116582-133116604 CAGTGAAAACAAAATTTAGAGGG - Exonic
1105817210 13:24047513-24047535 TTGTGAGAATAGAAGCAAGATGG + Intronic
1106612967 13:31301031-31301053 CTGTGAGACTAGAAGCAAGATGG + Intronic
1106823005 13:33487469-33487491 CTGTGAAAAGAAAAGAAAGGGGG + Intergenic
1107149788 13:37098097-37098119 CTGTGAAAGCTAAAGTAAAAGGG - Intergenic
1107405133 13:40105290-40105312 CCGTGAGTCCAAAAGTCAGATGG - Intergenic
1107894258 13:44944091-44944113 CTCTGACAACAATAGTAAAAAGG + Intronic
1107980561 13:45730596-45730618 CTTTGAGAATATAACTAAGATGG - Intergenic
1108240014 13:48454509-48454531 CTGGGAATACAGAAGTAAGATGG + Intronic
1110644862 13:77870570-77870592 CCGTGAGAAGGGAAGTAAGATGG + Intergenic
1110721948 13:78772023-78772045 GTGTGAGAGCAAAAGGGAGAGGG + Intergenic
1110879462 13:80553375-80553397 CGATGGGAACAAAAGAAAGAAGG - Intergenic
1111886999 13:94034183-94034205 CTGAGAGAAAGAAAGAAAGAAGG + Intronic
1111933849 13:94538910-94538932 CTCTTAGAACAAAAGGAAAAGGG - Intergenic
1111989971 13:95106776-95106798 GTTTGGGAACAAAAGAAAGATGG + Intronic
1112402795 13:99090014-99090036 ATGTGACAACAAAGGTAGGAAGG + Intergenic
1113004592 13:105685332-105685354 CTCTGTGAACAAAACTCAGAGGG + Intergenic
1113127627 13:106997852-106997874 CTGTGTGTACAAAAGTAAACGGG - Intergenic
1114053393 14:18943084-18943106 CTTTGAGGAGAAAAGCAAGATGG + Intergenic
1114109166 14:19458842-19458864 CTTTGAGGAGAAAAGCAAGATGG - Intergenic
1114515863 14:23300140-23300162 CTGTGAGGACAAGAGTGAAATGG + Intronic
1114683012 14:24502782-24502804 CAGTGAGCACAAAAGTATGGGGG - Intronic
1114810077 14:25888575-25888597 CTGTGAAAAAAAAATTAAGATGG - Intergenic
1114844743 14:26307863-26307885 CTGAAAGAACAAAAAGAAGAAGG - Intergenic
1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG + Intergenic
1115402991 14:32984404-32984426 CTTTGGGAAAAAAAGTAAGAGGG + Intronic
1116764063 14:49049520-49049542 CTGTGAGAATAAAATAAGGAGGG + Intergenic
1118686667 14:68298319-68298341 CTGGGAGAACAAAAGGAGAAAGG + Intronic
1118687717 14:68307920-68307942 TTGCAAGAACAACAGTAAGAGGG - Intronic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1120428987 14:84389834-84389856 CTGTGGGAACAGATGTAAGTTGG - Intergenic
1120962445 14:90137643-90137665 CGTTGAGAACAAATGAAAGAAGG + Intronic
1121638507 14:95469927-95469949 CTTTGATAACAAAGGTAGGAGGG - Intronic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1121797087 14:96744184-96744206 CTGTGGGAAGAGAAGTAAGGAGG + Intergenic
1122060726 14:99135060-99135082 TTCTGAGAACAAAATTCAGAGGG - Intergenic
1122292632 14:100687808-100687830 CTGTGTGAACCAGAGAAAGAGGG - Intergenic
1122760832 14:104024656-104024678 CTGTGACATCAATAGTTAGAAGG - Exonic
1124229832 15:27934875-27934897 CAGTGCGATTAAAAGTAAGAGGG - Intronic
1124696188 15:31866553-31866575 GTGTGAGACCAAGAATAAGATGG - Intronic
1125255036 15:37753423-37753445 GTATGAGAACAAGAGGAAGAGGG + Intergenic
1125522638 15:40356779-40356801 CTGTGCAAACAAAGGTAAGGGGG - Intergenic
1127062322 15:55199521-55199543 CTCTGACATCAAAGGTAAGAGGG - Intergenic
1127440445 15:59001247-59001269 CTCTGAGAACAGAGGTATGAAGG + Intronic
1127641260 15:60917936-60917958 CTCTGAGCACAAAAGTGGGATGG + Intronic
1127892691 15:63269262-63269284 CTGTGAGACCAAGAGGAAGGAGG - Intergenic
1128296469 15:66524866-66524888 ATGTGAGGGCAAAAGTATGATGG - Intronic
1130830125 15:87590873-87590895 TTGTGTGAAGAATAGTAAGAAGG + Intergenic
1131087179 15:89586934-89586956 CTGTTAAAACATAAGTCAGATGG - Intronic
1131923872 15:97360661-97360683 ATGAGAGAACAAAATTCAGAAGG + Intergenic
1132783890 16:1643756-1643778 CTCTGAGAACCAAATGAAGAGGG + Intronic
1133830176 16:9315693-9315715 CTGTGACATCAAAAGGGAGACGG + Intergenic
1135272682 16:21082942-21082964 CTGTTAAAAAAAAAGCAAGATGG - Intronic
1137819286 16:51428284-51428306 CTGTCAGAAAGAAAGAAAGAAGG - Intergenic
1138730774 16:59192404-59192426 CAGTGATCACAAAAGTAAAAAGG - Intergenic
1139143145 16:64292681-64292703 CTGTGAGGCTAAAAGCAAGATGG - Intergenic
1142584794 17:965348-965370 GTGTGATAACTAAAGTAAGCCGG - Intronic
1144118656 17:12127827-12127849 ATGTGTGCACAAAAGTAAGCAGG - Intronic
1144209415 17:13002122-13002144 CTTTGAGCACAAAAGAAACACGG - Intronic
1144455422 17:15414531-15414553 CTGGGAGTACAAAAGTGAGAGGG + Intergenic
1145374168 17:22332293-22332315 CTATAAGAAAAGAAGTAAGATGG - Intergenic
1145928142 17:28663094-28663116 CTGTAATATCAAAAGTAACAAGG + Intronic
1146534481 17:33638379-33638401 CTGTGAGGATAGAAGCAAGATGG + Intronic
1147950047 17:44102361-44102383 CTGTCAGAAAAAAAGAAAAAGGG - Intronic
1148385462 17:47231289-47231311 CTGTGAGAACAAAGCCAAGAAGG + Intergenic
1149623969 17:58066689-58066711 CTGTGAAAGGAAAAGAAAGAAGG + Intergenic
1149725558 17:58890418-58890440 CTGTGAGAGCTAAAACAAGAAGG + Intronic
1152466177 17:80467868-80467890 CTGTGTTATCAAAAGCAAGAAGG + Exonic
1153282207 18:3425229-3425251 CTGTGAGGATAGAAGCAAGATGG - Intronic
1153450251 18:5219189-5219211 CTGTGTGCACAGAAGTCAGAAGG - Intergenic
1153679024 18:7483017-7483039 CTGAGAAAAAAAAAGGAAGAGGG + Intergenic
1157067801 18:44372719-44372741 CAGGGAGAACAAAACTAAGTTGG - Intergenic
1157979105 18:52359815-52359837 CTGTGAGGAAAAAAATAATATGG - Intronic
1159599063 18:70411357-70411379 CTATGAGGACGGAAGTAAGAAGG + Intergenic
1160108475 18:76002643-76002665 TTTTGGGAACAAAAGTATGAGGG + Intergenic
1162331588 19:10033131-10033153 TTTTGAGGACAAAAGTCAGAGGG + Intergenic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1166235087 19:41449921-41449943 ATGTGATAACAGAAGTAGGAGGG + Intergenic
1168033425 19:53699797-53699819 CTTTGAGAACAAAACTCAGGAGG + Intergenic
1168386849 19:55970766-55970788 CTGTGAGAAAAGAAGTCATAGGG + Intronic
1168463876 19:56586383-56586405 TTGTTAGAACAAAATAAAGATGG - Intronic
1168632461 19:57968150-57968172 CTGTGAGGACACAACAAAGAAGG - Intronic
925328387 2:3040056-3040078 CTGTGAGAACTCTAGTAGGATGG - Intergenic
926007532 2:9384308-9384330 CTGTGAGGCCAGAAGCAAGATGG + Intronic
926833207 2:16988030-16988052 CTGAGAGAACACAACTAAGTGGG - Intergenic
926871470 2:17422632-17422654 CTGTGAGGTTAGAAGTAAGATGG + Intergenic
926984902 2:18612034-18612056 CTGAGAGTCCAAAAGTGAGAAGG + Intergenic
927004786 2:18836732-18836754 CTGTGAGGTCCAAAGTGAGAAGG + Intergenic
927039695 2:19215983-19216005 CTGTGACCACAAATGGAAGAAGG - Intergenic
927342476 2:21997911-21997933 ATGTGAGCACAAAAGACAGATGG - Intergenic
927965999 2:27268846-27268868 CTGTGAGCAAAGTAGTAAGATGG + Intronic
928685491 2:33745129-33745151 CTGTGAGAACAGTACCAAGAGGG - Intergenic
928776854 2:34775943-34775965 CTGTGATAACAAAATAAACAAGG + Intergenic
928852025 2:35759569-35759591 CTGTGAGAACATAAAGAAAATGG - Intergenic
928931194 2:36626103-36626125 CTGTGAGACTAGAAGCAAGATGG + Intronic
929040882 2:37743435-37743457 CTGTCACCACAAAAGTAAGAAGG - Intergenic
929246304 2:39707270-39707292 CAGTGAAAACAAAATTAACAGGG - Intronic
929941539 2:46337666-46337688 TTGTGAGATCCAAAGGAAGAAGG + Intronic
931441111 2:62291259-62291281 CTGTGAGGCCAGAAGCAAGATGG - Intergenic
933344894 2:81070998-81071020 CTGTAACAACAAAAGTCAGATGG + Intergenic
933872085 2:86576565-86576587 CTGGAAGAAGAAAAGAAAGAGGG + Intronic
934160435 2:89244497-89244519 CTGTGAGTAAACAAGCAAGATGG - Intergenic
934206842 2:89937941-89937963 CTGTGAGTAAACAAGCAAGATGG + Intergenic
934676099 2:96250689-96250711 CTGTGTGATCAAATGTATGAAGG + Exonic
934812334 2:97291081-97291103 CAGTGAAAATATAAGTAAGATGG + Intergenic
934825360 2:97416842-97416864 CAGTGAAAATATAAGTAAGATGG - Intergenic
935254025 2:101292399-101292421 CTTTGAGAACACAAGTAAATTGG - Intronic
935385436 2:102494178-102494200 CCTTAAGAACCAAAGTAAGAAGG - Intronic
935411636 2:102770585-102770607 CTGTGAGAAGAGAAGAAAGGAGG - Intronic
935687018 2:105693144-105693166 CTGTGATAACAGAAGTGAAATGG + Intergenic
935744641 2:106179658-106179680 CTGTAAGAACAACAGTTTGAAGG + Intronic
937669137 2:124519923-124519945 CCATGAGAACAAAAGTGAAAAGG + Intronic
937763171 2:125629693-125629715 CTGGGAAAACAAAAGAAACAAGG + Intergenic
938186187 2:129234085-129234107 CTGTGAGAAAAAAGGCAAGTGGG + Intergenic
938471360 2:131565590-131565612 CTTTGAGAAGAAAAGTGAGATGG + Intergenic
938472973 2:131582789-131582811 CTTTGAGAAGAAAAGCAAGATGG + Intergenic
939091821 2:137788916-137788938 CTGTGAGAATTAAAGTATGATGG + Intergenic
940039861 2:149348780-149348802 CTGTGAGAATAAATATAGGAAGG + Intronic
940190031 2:151030986-151031008 CCGTTAGAATAAAACTAAGAAGG + Intronic
940791083 2:158031056-158031078 TTATGAGAATAAAAATAAGAAGG + Intronic
941416862 2:165231705-165231727 CAGAGAGAACAAAAAGAAGAGGG - Intergenic
941652797 2:168111613-168111635 ATGTGAGAACTAAAATAAGTTGG - Intronic
941960116 2:171245222-171245244 CTGTGAGACTAGAAGCAAGATGG - Intergenic
942665920 2:178317375-178317397 CCGTGAGATCAAATGTAAGCAGG - Intronic
942766206 2:179460277-179460299 CTGTGAGAATAGAAGCAAGATGG - Intronic
942917976 2:181335511-181335533 CACTTACAACAAAAGTAAGAAGG - Intergenic
942988442 2:182169850-182169872 CATGGACAACAAAAGTAAGAAGG - Intronic
942990497 2:182195298-182195320 GTGATAGAACAAAAGTAAGAGGG - Intronic
943162792 2:184277337-184277359 CTGTCACAGCAAAAGAAAGATGG + Intergenic
943464475 2:188211591-188211613 TTGAGAGAACATAAATAAGAAGG + Intergenic
943850349 2:192712937-192712959 TTCTGAAAAGAAAAGTAAGATGG + Intergenic
944083065 2:195811855-195811877 CTGTGAGGCCAGAAGCAAGATGG - Intronic
945461529 2:210115566-210115588 TTGTGAGAACAAGAGTAAACTGG + Intronic
945530011 2:210941343-210941365 CTTTGAGAAAGAAAGTGAGAAGG + Intergenic
946320447 2:218951027-218951049 CTGTAAGAAAAAAATTAAAAGGG - Intergenic
946430202 2:219622166-219622188 CTGGAAGAACAAAAGGCAGAAGG + Intergenic
946524087 2:220498775-220498797 CTCTAAGAAAAAAATTAAGAGGG - Intergenic
947243108 2:228017832-228017854 CAGTGAGATCAAGAGGAAGACGG - Exonic
947376055 2:229496034-229496056 CTGTAAGAACAGGAGCAAGAAGG - Intronic
947938612 2:234028457-234028479 ATATGAAAAGAAAAGTAAGAGGG - Intergenic
948895962 2:240926976-240926998 GTGTGAGAACAAATGCCAGAAGG + Intronic
1169492074 20:6079802-6079824 CAGAGAGAAGAAAAATAAGATGG + Intronic
1169693434 20:8359119-8359141 CTGTCAGACCAAAAGTGGGATGG - Intronic
1173280297 20:41620923-41620945 GTGTGAGAGCAAGAGGAAGATGG + Intergenic
1173381977 20:42553674-42553696 GAGTGAGAACAAAAATAAAAAGG - Intronic
1173425537 20:42940099-42940121 CTGGTAGAACTAAAGTAATAAGG - Intronic
1174029807 20:47613945-47613967 CTGTGAGGAGATAAGTAGGAGGG - Intronic
1175049593 20:56142351-56142373 GTGTGAGATTAGAAGTAAGATGG + Intergenic
1176916271 21:14629465-14629487 CTGTGAGAATAAAATGAAGAAGG + Intronic
1177086154 21:16707248-16707270 GTGTGAGAAAAAAAGCAATAGGG + Intergenic
1177484490 21:21739624-21739646 ATATGAGAACAAAAGTAAATTGG - Intergenic
1177549429 21:22600644-22600666 CTGTGAGACTACAAGCAAGATGG + Intergenic
1177636913 21:23799165-23799187 ATCTGAGAGCAAAAGGAAGAGGG + Intergenic
1177902831 21:26937897-26937919 ATGTTAAAACAAAAGGAAGAAGG - Intronic
1178171583 21:30047084-30047106 CTATAAGAACAAAATTAATAGGG + Intergenic
1178791450 21:35704173-35704195 CTGTGTGAACACAAGAAGGAAGG - Intronic
1180471862 22:15665459-15665481 CTTTGAGGAGAAAAGCAAGATGG + Intergenic
1181677063 22:24462168-24462190 CTGTCAGAATATAAGTAAGTTGG + Intergenic
1182290567 22:29275582-29275604 CTGTGTGAACAAAACTTAGCAGG + Intronic
1182783294 22:32885352-32885374 CCTTGAGAACAAGAGTCAGAAGG - Intronic
1183050070 22:35253742-35253764 CTGAGAGAACAGAGTTAAGAGGG + Intergenic
1184133554 22:42532414-42532436 ATGTGAGGTCCAAAGTAAGAAGG + Intergenic
1184814985 22:46862445-46862467 CCCTGAGAACAGAAGCAAGAGGG - Intronic
951969218 3:28424430-28424452 AAATGAGATCAAAAGTAAGAAGG + Intronic
953731297 3:45450789-45450811 CTGTGTGAAAAACAGTAAGGTGG - Intronic
953961915 3:47273111-47273133 CTGAAAGATCAAAAGCAAGAAGG - Intronic
954534433 3:51348456-51348478 CTCTGAGAACAAAATAAACAGGG + Intronic
954776507 3:53023752-53023774 CTGTAGGAACAAAAGGGAGAAGG - Intronic
955714213 3:61811401-61811423 CTGTGGGACCAAAAGCAAGAGGG - Intronic
957284804 3:78204238-78204260 CTGTTAGAAGAAAAGATAGATGG - Intergenic
957437296 3:80194987-80195009 CTGTGAGAAGAAAATCAAGGTGG - Intergenic
957477310 3:80741146-80741168 CTTTGACATCAAAAGGAAGAGGG + Intergenic
957666278 3:83233137-83233159 CTGGGAGAATGAAAGTAAAAGGG - Intergenic
957760807 3:84553610-84553632 CTGTAAGAACAATAAAAAGATGG + Intergenic
958901191 3:99888133-99888155 CTCTGAGAATAAAAATAAAATGG + Intronic
959370565 3:105520274-105520296 CTGTGAGTACAAATGTAGGAAGG + Intronic
960721029 3:120624545-120624567 CTCTGAGAAAGAAAGAAAGAAGG + Intergenic
960829952 3:121835456-121835478 CTGTGGGAACAAAACCCAGAGGG - Intronic
962915998 3:139904280-139904302 CTGTGAGAACATAAAGAAAAAGG + Intergenic
964585876 3:158301188-158301210 TTGTGAAAAGAAAAATAAGATGG - Intronic
964836606 3:160946177-160946199 CTGGGCTAAGAAAAGTAAGATGG - Intronic
965089298 3:164142732-164142754 CTGTGTGTACAAAAATAACAGGG - Intergenic
965870723 3:173261238-173261260 CTGTGAGGCTAGAAGTAAGATGG + Intergenic
966667931 3:182493371-182493393 CGGTGAGGATAAAACTAAGATGG + Intergenic
967621375 3:191638784-191638806 CTGTGAAGACAAGAGGAAGATGG + Intergenic
968173290 3:196527695-196527717 CTTTGAAAAGAAAAGAAAGAAGG + Intergenic
969130704 4:4989291-4989313 CTGAGACAGCAAAAGAAAGAAGG - Intergenic
970723969 4:19021020-19021042 CTGTAAAAGCAAAAGTGAGATGG - Intergenic
971182215 4:24339464-24339486 CAGTGTGAACAAAGGTAAAAAGG - Intergenic
971276857 4:25206548-25206570 CAGTGAGAACAAGAGAAAGATGG - Intronic
972137445 4:35909165-35909187 CTGTAAGATCAAAAGCAAGTTGG - Intergenic
972694214 4:41428954-41428976 CAGTCAGAAAAAAAGTAAGAAGG - Intronic
972803760 4:42506319-42506341 ATGTGAGAACACAGTTAAGAAGG + Intronic
972996823 4:44890349-44890371 CTGTGAAAGCAATATTAAGAGGG - Intergenic
973180115 4:47256749-47256771 CTGTCAGAAGAACAGCAAGAGGG + Intronic
973933208 4:55814626-55814648 CTCTGAAAACAAAATTAATAAGG + Intergenic
974267899 4:59609481-59609503 CTGAGAGAATAAATTTAAGAAGG + Intergenic
974354965 4:60799865-60799887 CTGGAAGAATAAAAGTGAGAAGG - Intergenic
974618525 4:64323571-64323593 CTGTGTGAAAAATAGAAAGAAGG + Intronic
974822939 4:67091150-67091172 GTGTGAAAAGATAAGTAAGATGG - Intergenic
975008234 4:69317681-69317703 CTGTGAGGAGAAAAGGAACATGG - Intronic
975312809 4:72921956-72921978 CAGTGAAAACAATACTAAGAGGG - Intergenic
975755590 4:77568435-77568457 CTGAGAGGAGAAAAGTAAAATGG - Intronic
975793893 4:77984910-77984932 CTGTAAGAACTAAAATAACAAGG + Intergenic
976218895 4:82740330-82740352 CTAGGAGCACAAAAGTCAGAGGG + Intronic
976456732 4:85256609-85256631 CTCTGAGAACAAAAGAGAGATGG - Intergenic
977743656 4:100518277-100518299 CTTTCAAAACAAAAGTTAGAAGG - Intronic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
978594891 4:110366840-110366862 CTTTGAAAAGGAAAGTAAGAAGG - Intronic
979365375 4:119815916-119815938 CTTTCAGAACAAAAATCAGAAGG - Intergenic
979753739 4:124312944-124312966 CTGTGAGAAGAAAAACAAAAAGG - Intergenic
979986611 4:127324023-127324045 CGGTGAGAGAGAAAGTAAGAGGG - Intergenic
980573335 4:134652123-134652145 CTGTGAGAGGAAAAGTGATATGG + Intergenic
981009765 4:139913628-139913650 CTGTGAGAGCAAAAGAACCAAGG + Intronic
982429058 4:155300727-155300749 TTGTAACAACAAGAGTAAGAAGG + Intergenic
983095240 4:163553503-163553525 CTATGTGAACAAAGATAAGAAGG + Intronic
984602109 4:181739722-181739744 CTGTGATAATAAATGTACGACGG - Intergenic
987866035 5:23540357-23540379 CCCTGAAAACAAAAGGAAGAAGG - Intergenic
988339191 5:29947426-29947448 CTGCGAGGACAAAAATCAGAGGG - Intergenic
989605160 5:43237218-43237240 CAGAGAGAACAAAGGTGAGATGG + Intronic
990325545 5:54671880-54671902 CTGTGAGACTAGAAGCAAGATGG - Intergenic
990948729 5:61275889-61275911 CTCTGAGAACAAAGGGGAGAGGG - Intergenic
991150862 5:63367568-63367590 CATTGAGAACAAATGTAACAAGG + Intergenic
992094391 5:73348205-73348227 CTGGAAGAAAAACAGTAAGAAGG + Intergenic
992445927 5:76833438-76833460 CTCAGAGAAGAAAAGGAAGAGGG + Exonic
993621444 5:90173005-90173027 ATGAGAGAACAAAAATTAGAGGG - Intergenic
993738502 5:91507224-91507246 CTGGTAGAACCAAAGGAAGAAGG + Intergenic
993802142 5:92355260-92355282 TTATGAGAACAAAAGCAGGATGG - Intergenic
994157425 5:96519605-96519627 CTTGAAGAAAAAAAGTAAGACGG - Intergenic
995289208 5:110430355-110430377 CTCTGAGAACAAAAAAAAAAAGG - Intronic
995609383 5:113892775-113892797 CTGTTAGAATCAAAGTAACAAGG - Intergenic
997776840 5:136616786-136616808 CTGTTAGAACACAAGTAAGGTGG - Intergenic
998152853 5:139766997-139767019 CTCTGAGAAAGAAAGAAAGAAGG - Intergenic
998652619 5:144138555-144138577 CTCTGACAACAAAGGTAAAAAGG - Intergenic
998772154 5:145557949-145557971 CTGTGAGAACAAAAGTAAGATGG + Intronic
999310188 5:150546805-150546827 CCTAGAGAACAAGAGTAAGAAGG - Intronic
999377782 5:151098786-151098808 CTCTGAGGACAAATGTAGGAAGG - Intergenic
1000938721 5:167334614-167334636 TTATGAGAACAAAAGAAAAAAGG - Intronic
1000960107 5:167590561-167590583 CTGGGAGAAAAAAAATAAAAAGG - Intronic
1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG + Intronic
1001575273 5:172759236-172759258 CTGGGAAAAGAAAAGTCAGAGGG + Intergenic
1002078612 5:176724570-176724592 CTGTGAGAACAAAAATAGAAAGG - Intergenic
1002725773 5:181295024-181295046 CTGTAAGAACAAAAAGAAAAAGG - Intergenic
1002806173 6:576427-576449 CTGTGAGAACTTCATTAAGATGG - Intronic
1003585869 6:7389017-7389039 CTGTAAGGACAAATGAAAGATGG - Intronic
1003666769 6:8118723-8118745 CTGAAGGAAAAAAAGTAAGATGG - Intergenic
1004232691 6:13847303-13847325 CTGTGAGATTAGAAGCAAGATGG - Intergenic
1005095635 6:22112033-22112055 CTTTGAAAATAAAAGTAAAAGGG - Intergenic
1005572387 6:27157780-27157802 CTTTGGCAACAAAAGGAAGAGGG - Intergenic
1006311966 6:33267308-33267330 CTTTGAGAAGAATCGTAAGATGG + Exonic
1006489601 6:34375777-34375799 CTGTTAGAAGAATGGTAAGATGG - Intronic
1006865624 6:37206970-37206992 CTGTATGAAGAAAAGTAGGACGG + Intergenic
1008103412 6:47416897-47416919 CTGTGAAGCCAAAAGCAAGATGG + Intergenic
1008199043 6:48563681-48563703 GAGAGAGAACAAAAGTGAGAGGG - Intergenic
1008302983 6:49865557-49865579 TTGTGAAAACAAAAGGAAGGTGG + Intronic
1008369478 6:50715893-50715915 CTGTGAGGACAAACCAAAGATGG - Intronic
1009370752 6:62898652-62898674 CTGTGGAAACTTAAGTAAGAAGG + Intergenic
1010976976 6:82326145-82326167 CTGTGAGAACAAAGAGAACAGGG - Intergenic
1012242282 6:96887371-96887393 CTGTGAGGAAAAAGGTAACAAGG - Intergenic
1013431880 6:110063082-110063104 CTCTGAGAACAGAAGTAACTTGG + Intergenic
1013996679 6:116317001-116317023 CTGTGAGAAAAAAAATGTGAAGG + Intronic
1014173870 6:118309962-118309984 CTTTGAGAACACAGGTCAGAAGG - Intronic
1014671597 6:124311583-124311605 ATGTGAAAACAAATGTAAGCAGG + Intronic
1017752375 6:157500031-157500053 CTGATAGAAGAAAATTAAGAAGG + Intronic
1018132758 6:160748300-160748322 ATGTGAGAAAGAAAGAAAGAAGG + Intronic
1018907847 6:168085602-168085624 CTGTGAGAACAAAGGGACCAAGG + Intergenic
1019229246 6:170544286-170544308 CTGTGAGAACAGAAGACACAGGG + Intronic
1019835393 7:3378221-3378243 ATGTGAGACCAAAACTATGAGGG - Intronic
1020107082 7:5427112-5427134 CTGGGTAAACAAAAGTATGAGGG - Intergenic
1020352313 7:7234280-7234302 CTGTAAGAACAAAAATTAGCAGG - Intronic
1020753626 7:12172536-12172558 GTGTGGGAACTATAGTAAGAGGG + Intergenic
1021420963 7:20444251-20444273 CTGTGAGACTAGAAGCAAGAAGG - Intergenic
1021460601 7:20882717-20882739 CTGTGAAGAGAAAAGTAAAATGG - Intergenic
1021497730 7:21294482-21294504 AGGTGAGAACACAAGTGAGAAGG - Intergenic
1021723174 7:23524564-23524586 CTCTGAGATAAAAAGAAAGAAGG - Intronic
1021781619 7:24112660-24112682 ATGTGAGAAGAGAAGTAAAATGG - Intergenic
1022376396 7:29815643-29815665 CTGTGAGAACACAAGCATGCTGG - Intronic
1022433508 7:30353979-30354001 CAGTGAGAACAAAAAGAAAAAGG - Intronic
1022890954 7:34698909-34698931 CAGTGAGAACAAAAATATAAAGG + Intronic
1024587441 7:50854224-50854246 TTGAGAGAAGAAAAGGAAGATGG + Intergenic
1024860775 7:53837296-53837318 CAGTGAAAACAGCAGTAAGAGGG + Intergenic
1025135607 7:56409210-56409232 CTGTAAGAACAAAAAGAAAAAGG + Intergenic
1026128927 7:67604603-67604625 CTGTGAGGTTAAAAGCAAGATGG - Intergenic
1027457434 7:78410698-78410720 CAGGGAGAAAAAGAGTAAGATGG + Intronic
1027915014 7:84306708-84306730 ATGTGAGGTCAAAATTAAGATGG + Intronic
1030318497 7:108140667-108140689 CTGTGTGAAGAAAAGAAAGGGGG + Intergenic
1030655164 7:112159562-112159584 CTGTTAGAGCAAAAGAAATACGG - Intronic
1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG + Intronic
1031684806 7:124720450-124720472 CTGTGTAAACAAATGTAAGGTGG - Intergenic
1033108380 7:138552452-138552474 CTGTGAGAAATTAAGAAAGAAGG - Intronic
1033247036 7:139726386-139726408 ATGTGAGAGCAAAGGAAAGAGGG + Intronic
1033610994 7:142962972-142962994 GTGTGAAAACAAAATTAAAATGG - Intergenic
1035107598 7:156455213-156455235 CTGTGAGCAAATAAATAAGATGG + Intergenic
1035181565 7:157093113-157093135 CGGTGAGGACAGAGGTAAGATGG - Intergenic
1035873571 8:3162634-3162656 CTTGAAAAACAAAAGTAAGAGGG - Intronic
1036093018 8:5689972-5689994 CTTTGTGTACAAAGGTAAGATGG + Intergenic
1037689918 8:21172935-21172957 CTGGGTGCACAAAAGTTAGAAGG - Intergenic
1038520035 8:28223748-28223770 CTTTGAGAGAAAAAATAAGATGG - Intergenic
1041054763 8:53973153-53973175 ATGGGAAAACAAAAGTCAGAAGG + Intronic
1041980381 8:63851379-63851401 ATGTGAAAAAAAAAGCAAGAGGG - Intergenic
1042088048 8:65130206-65130228 CTGTGAGAAAAAAAAAAAGTCGG - Intergenic
1044194904 8:89363722-89363744 CTTTCAGAACAAAAATAAAAAGG + Intergenic
1044233103 8:89801464-89801486 CTGTGAGACTAGAAGCAAGAGGG - Intergenic
1045370826 8:101521071-101521093 CTGTGAGAAAAAAATACAGAGGG + Intronic
1047397663 8:124516974-124516996 CTGTAAGAACAGAAGTTACATGG + Intronic
1049198896 8:141330315-141330337 TTGTGAGAAGAAGAGGAAGAGGG - Intergenic
1049862656 8:144910517-144910539 ATGTGAGCACAAAGGAAAGAGGG + Intergenic
1049950013 9:634741-634763 CTGTGAGGCCAGAAGCAAGATGG + Intronic
1050117087 9:2274470-2274492 CTGTTAAAAAAAAAGGAAGAAGG + Intergenic
1050721581 9:8597541-8597563 CAGTGAAAATAAAAGGAAGAAGG + Intronic
1051153098 9:14106809-14106831 CTTTGGGAACAAAAGAAAGAAGG + Intronic
1051559346 9:18422895-18422917 CTGTGAGAAAGAATGTTAGAGGG - Intergenic
1052045167 9:23785544-23785566 GTGTGAAAACAAAAATAACAAGG + Intronic
1052080118 9:24194592-24194614 CTGTGAGAGCTAAAATATGATGG + Intergenic
1052193537 9:25684693-25684715 TTGTGAGAACAAAATCAAAAGGG - Intergenic
1052497844 9:29250447-29250469 CTGTTGTAACAAAAATAAGATGG + Intergenic
1053453982 9:38216926-38216948 CTGTTAGAACAAAAGTAGTAAGG + Intergenic
1055783797 9:79849677-79849699 CTGTGGAAACAAAAGTAAAGAGG + Intergenic
1056673593 9:88653336-88653358 CTTTGAGAACTAAAATAGGATGG - Intergenic
1058925317 9:109657426-109657448 TTCTGAGAACAAAAGCAATATGG + Intronic
1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG + Intronic
1060048878 9:120362650-120362672 GTGTGAGAACCAACATAAGATGG - Intergenic
1060181502 9:121537596-121537618 CTGGGAGAAGAAAAACAAGAAGG + Intergenic
1060216196 9:121739922-121739944 CTGTGAGAACAGAGGAAAGCTGG + Intronic
1060284778 9:122240012-122240034 CTGTGTGAATAAATGTAAGACGG - Exonic
1060586139 9:124787181-124787203 CTGTGAGAACGAGTGGAAGATGG + Exonic
1061830042 9:133285905-133285927 CTGTAAGGACAAAGGAAAGAGGG - Intergenic
1061832647 9:133305218-133305240 CTGTTAGAAAAAAAACAAGAAGG + Intergenic
1185609960 X:1388389-1388411 CTGTGAGGACACAGGGAAGACGG + Intronic
1186736045 X:12465130-12465152 CTCTGAAAACAGAAGTCAGAAGG + Intronic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1188361643 X:29262093-29262115 CCTTGAGTACAAATGTAAGATGG + Intronic
1190043078 X:47087641-47087663 CTGTGAGACAAAAATAAAGATGG + Intronic
1190882824 X:54505111-54505133 ATGAGAGAACAAGAGTGAGAGGG - Intergenic
1191842608 X:65523875-65523897 CTCTGAGAAGAAAAGGAAAAGGG + Intronic
1193260595 X:79402740-79402762 TTGAGAGAACAAGAGCAAGATGG + Intergenic
1193866382 X:86736368-86736390 CTTTGAGAACATAATTTAGAAGG - Intronic
1194574516 X:95595640-95595662 AAGTGACAACAAAAGTAAGATGG - Intergenic
1199343755 X:146714014-146714036 CTGTGAAAATAAATGTAACACGG - Intergenic
1199462295 X:148098254-148098276 GTTTGAGAAAAAAAGAAAGAAGG + Intergenic
1199498207 X:148477934-148477956 CAGGGAGAAGAAAAGTAAGAAGG + Intergenic
1201235880 Y:11911109-11911131 CTGAAAGAAAAAAAGAAAGAAGG - Intergenic
1201621970 Y:15969389-15969411 CAGTGACAACAAAAGTAAATGGG - Intergenic
1202034891 Y:20622023-20622045 CTGTAAGAATTAAAGAAAGAGGG - Intergenic