ID: 998778865

View in Genome Browser
Species Human (GRCh38)
Location 5:145633903-145633925
Sequence CTATGGGAATGCAGGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998778865_998778873 10 Left 998778865 5:145633903-145633925 CCATGTTCCCTGCATTCCCATAG 0: 1
1: 0
2: 1
3: 20
4: 248
Right 998778873 5:145633936-145633958 GATCCTTTCCTCCTCCCACTGGG 0: 1
1: 0
2: 1
3: 31
4: 255
998778865_998778872 9 Left 998778865 5:145633903-145633925 CCATGTTCCCTGCATTCCCATAG 0: 1
1: 0
2: 1
3: 20
4: 248
Right 998778872 5:145633935-145633957 GGATCCTTTCCTCCTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998778865 Original CRISPR CTATGGGAATGCAGGGAACA TGG (reversed) Intronic
901041862 1:6368776-6368798 CCCGGGGAATGCAGGGCACAGGG + Intronic
902987334 1:20162922-20162944 CCATGGAAATGCAGTGGACATGG - Intronic
905117741 1:35656974-35656996 CTAGGGCAATGCATGGAACTTGG - Intergenic
907051319 1:51331233-51331255 CACTGGGAATGCAGGGGAGAGGG - Intronic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
908043640 1:60144081-60144103 CTATGGGAAGTCATGGAACTAGG - Intergenic
908785648 1:67732375-67732397 CCATGGGAAGTCAGGGAACAAGG - Intronic
912993061 1:114508731-114508753 CTATGGGAATGGAGGGATGGGGG - Intronic
914603193 1:149227219-149227241 GTATGTGGATGCAGTGAACAGGG + Intergenic
915324347 1:155073153-155073175 TTATGGGAACACAGGGAAAACGG + Intergenic
915910217 1:159910349-159910371 CTATGGGAATGTGGGGAAGGGGG - Intergenic
915959141 1:160249946-160249968 CTATAGGAATAGAGGGATCAGGG + Intronic
917047011 1:170872183-170872205 CTATGGAAGTGCTGGGAAAAGGG + Intergenic
917625710 1:176843885-176843907 CCATGGAAATGCATGGAGCAAGG + Exonic
918807148 1:189062923-189062945 CTATGTGAATACAGGGCACCTGG - Intergenic
919914090 1:202129446-202129468 CTATGGGAAAGCACCTAACAAGG - Exonic
921932487 1:220766020-220766042 CTAGGAGAGTGCAGGGACCACGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1063780757 10:9320614-9320636 CTGTTGGAATGCAGTGAACAAGG - Intergenic
1065130251 10:22613080-22613102 CAATGGGAGTGAAGGGAAAAGGG + Intronic
1065225525 10:23539612-23539634 CTAGGGCAATGCTGGGGACATGG + Intergenic
1066689787 10:38014780-38014802 GTATGGAAATGCAAGGAACTAGG - Intronic
1067002921 10:42634496-42634518 GTATGGAAATGCAAGGAACTAGG + Intronic
1067102032 10:43340792-43340814 CAGTGGGAATGCAGGAAGCACGG + Intergenic
1069597982 10:69684973-69684995 CTGGGGGAATGCTGGAAACAAGG + Exonic
1070127158 10:73631811-73631833 TTATGGGAATGGAGGGAAAAAGG - Exonic
1071281899 10:84111034-84111056 CTATTGGACTGAAGGGAACTAGG + Intergenic
1071294889 10:84212263-84212285 CTATGTGAAGGCAGAGGACATGG + Exonic
1073326905 10:102648455-102648477 CTCTGAAAATGCAAGGAACAGGG - Intronic
1074007649 10:109444481-109444503 CTAGGTGAATGTATGGAACAGGG - Intergenic
1074015473 10:109529902-109529924 CTGGGGAAGTGCAGGGAACAGGG + Intergenic
1074422428 10:113321103-113321125 CCACAAGAATGCAGGGAACAAGG - Intergenic
1077835813 11:5927121-5927143 CTTTGGGAATGCAGTGATTATGG - Intronic
1078623142 11:12927101-12927123 CTATGCAAATTCAGGGAGCAGGG + Intronic
1078841498 11:15079782-15079804 CTATGGGAATAAAGAGAAGAAGG + Intronic
1079471726 11:20784842-20784864 GTTTGGCAATGCAGGAAACAAGG + Intronic
1079992824 11:27264919-27264941 CTATGTGCTAGCAGGGAACAAGG + Intergenic
1081192412 11:40119988-40120010 TTATGGGAAGGCAGGGTAAATGG - Intronic
1085653137 11:78286746-78286768 TTATCAGAATGAAGGGAACAAGG - Intronic
1086037417 11:82433408-82433430 CTCTGTGAATGAAGGGACCAAGG - Intergenic
1086832615 11:91584035-91584057 CTGTGGGAGGGCAAGGAACAAGG - Intergenic
1086909934 11:92460356-92460378 ACATGGCAATGCAGGGATCATGG - Intronic
1088824697 11:113483820-113483842 CTGAGGGAAGGCTGGGAACATGG - Intergenic
1089081599 11:115780830-115780852 CTATGCAAATGAAGGGAACTGGG + Intergenic
1089828567 11:121303003-121303025 AGATGGGAATGCAGGGGACTAGG - Intronic
1090039614 11:123278965-123278987 CTCTGTGAAGGCAGGGATCAAGG - Intergenic
1090350618 11:126105574-126105596 CTCTGGGCATGCTTGGAACATGG - Intergenic
1091689559 12:2586501-2586523 GTATGGGATTTCAGGGAGCAGGG - Intronic
1092024053 12:5226034-5226056 GTATGGGAATCCAGGAAAAATGG - Intergenic
1092143250 12:6198535-6198557 TTACGGGATTGCATGGAACATGG - Intergenic
1092275987 12:7061291-7061313 CTAGGGGAAGGCAGGGACCCTGG - Intronic
1092929727 12:13304635-13304657 CTATGTGAATGCACTGAACTTGG - Intergenic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1095252731 12:39997878-39997900 TGATGGGGATGCAGTGAACAGGG + Intronic
1095857208 12:46873477-46873499 CTATGGACATCCAGGTAACATGG - Intergenic
1099446925 12:82764087-82764109 ATATGGGAAAGCAGAAAACATGG + Intronic
1099492971 12:83308504-83308526 CTGAGGGAATGCAGTGAAAAGGG - Intergenic
1101257553 12:102993447-102993469 CTCTGGGAATCCAGGAAGCAAGG + Intergenic
1101324754 12:103705839-103705861 CAATGATAATGCAGGTAACAAGG - Intronic
1103130511 12:118464451-118464473 CTTTGGGGATGCAGGGGAAAGGG - Intergenic
1104007791 12:124906284-124906306 CAATGGGATTTCAGGGAAAATGG + Intergenic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1106329596 13:28727269-28727291 CTCTGTGCATGCAGGGACCATGG + Intergenic
1108440917 13:50451781-50451803 ATGTGGGAAGGCAGGGAGCAGGG + Intronic
1110412901 13:75222962-75222984 ACATGGGAAGGCAGGGGACAGGG - Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111549588 13:89789361-89789383 CTATGGGACTACAAGGAAAACGG + Intergenic
1113532407 13:111037810-111037832 CTCTGGGACTGGAGGGATCAGGG + Intergenic
1113698327 13:112364588-112364610 ATCTGGGAAGGGAGGGAACAGGG + Intergenic
1116984105 14:51201918-51201940 CAAAGGGAACGCAGGGAACAGGG - Intergenic
1117437373 14:55729541-55729563 CTATGGGAAGGCAGGGGACAGGG + Intergenic
1119082951 14:71713753-71713775 CAATGAGGGTGCAGGGAACAGGG - Intronic
1119540785 14:75436885-75436907 CTCTGAGAATGAAGAGAACATGG + Intronic
1120099576 14:80428810-80428832 CAATGGGAATGAAGGAATCATGG + Intergenic
1120290858 14:82569034-82569056 ATATGGGAAAGCAAGGATCATGG - Intergenic
1121055467 14:90848307-90848329 CTATAGCAACGAAGGGAACATGG + Exonic
1122049132 14:99043177-99043199 CTCTTGGAAGGCAAGGAACATGG + Intergenic
1124001064 15:25760416-25760438 CTATGGCAATGCAGTTGACAAGG - Intronic
1124662593 15:31562454-31562476 CTATGGGAAGGCAGGGCAGGGGG - Intronic
1125717890 15:41830080-41830102 CCTCGGGGATGCAGGGAACAGGG - Intronic
1127417883 15:58774622-58774644 CTATGGAAGTGCAGAGAAAACGG + Intronic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1129590751 15:76912756-76912778 CTATGGGAATGTTGGCATCATGG + Intergenic
1130064710 15:80594128-80594150 CTGGGGGAATGCTGGGAAAATGG + Exonic
1130793342 15:87180255-87180277 CTATGTGAAGGCACTGAACATGG + Intergenic
1130919933 15:88335445-88335467 CTGTGGGAACTCAGGGAGCAGGG + Intergenic
1134314494 16:13105973-13105995 CTATGGGAATAGAGAGACCAGGG - Intronic
1135207919 16:20498905-20498927 CCTTGGGGATGCAGGGCACAGGG - Intergenic
1135210980 16:20524795-20524817 CCTTGGGGATGCAGGGCACAGGG + Intergenic
1136778466 16:32883674-32883696 CTATCAGGATGCAGGGAATAAGG + Intergenic
1136892154 16:33977840-33977862 CTATCAGGATGCAGGGAATAAGG - Intergenic
1137587838 16:49674749-49674771 AGATGGGAAGGCAGGGAAGAGGG + Intronic
1203080888 16_KI270728v1_random:1145783-1145805 CTATCAGGATGCAGGGAATAAGG + Intergenic
1143724346 17:8835214-8835236 GTATGGGCATGCAGGGACGAGGG + Intronic
1144996457 17:19272610-19272632 AGATGGGAATCCAGGGATCAGGG - Intronic
1145010455 17:19364918-19364940 CCATAGGCATGCAGGGAAGAGGG - Intronic
1145275901 17:21430220-21430242 CTTTTGGAAGGCAGGGAACAAGG - Intergenic
1145313748 17:21716133-21716155 CTTTTGGAAGGCAGGGAACAAGG - Intergenic
1145712188 17:26988106-26988128 CTTTTGGAAGGCAGGGAACAAGG - Intergenic
1146937232 17:36819495-36819517 CTCTGGGAGGGCAGGGAACCTGG - Intergenic
1148228392 17:45915784-45915806 CATTGGAAATGCAGGGAACAGGG - Intronic
1149076273 17:52598603-52598625 CTATGTGTATGCAGGGCACCTGG - Intergenic
1149146137 17:53495649-53495671 CTAAGTAAATGAAGGGAACAGGG + Intergenic
1150225099 17:63520243-63520265 CTATGGGACTGCAGTGCCCAAGG + Intronic
1152103590 17:78316473-78316495 GAATGGGGAGGCAGGGAACAAGG - Intergenic
1152494375 17:80660797-80660819 CGATGGGAATGGGGGGACCAAGG - Intronic
1153019297 18:612126-612148 CTATGGGAAAGCAAGGTAGAAGG - Intronic
1155292616 18:24356770-24356792 CTAAGAGAATGCAGGGGCCATGG + Intronic
1155379756 18:25207094-25207116 CTTTGGAAATGCAGAGAATATGG - Intronic
1156115611 18:33783888-33783910 CTATAGGAATACAGATAACAAGG - Intergenic
1156731499 18:40198808-40198830 CTATGGGAATTCAGTGAAAGAGG - Intergenic
1156751170 18:40457509-40457531 CTATAAGAAAACAGGGAACAAGG + Intergenic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1158609115 18:58922879-58922901 CTAGGGAAACGCAGGGAATAAGG - Intronic
1159390728 18:67789001-67789023 CCACAGGAATGCAGGGGACAGGG + Intergenic
1159441842 18:68490459-68490481 CTATGTGAATGCAGGTGACAGGG + Intergenic
1159554230 18:69928498-69928520 CCGGGGGAATGCAGGAAACATGG + Intronic
1161326344 19:3665995-3666017 CTGGGAGAATGCAGGGAACATGG - Intronic
1163038834 19:14587717-14587739 CTGGGGGAATACAGGGAACGGGG + Intronic
1163039579 19:14592384-14592406 CTGGGGGAATACAGGGAACAGGG + Intronic
1164286231 19:23820142-23820164 CCCTGGGAATGCAGGAAATAGGG - Intronic
1164744478 19:30601073-30601095 CTGTGGGAACACAGGGAATATGG - Intronic
1167267308 19:48489989-48490011 CTCTGGGAGAGCAGGGCACACGG - Intronic
1167491673 19:49796104-49796126 CTATGGTAATTCAGGTAGCACGG - Intronic
1168311910 19:55464775-55464797 ATATAGGAAGGCAGGGAACAGGG + Intergenic
924978522 2:199031-199053 CTGTGGGAATGCAGGGGGCCAGG - Intergenic
926171146 2:10553222-10553244 CCTTGGGAATGGAAGGAACAGGG + Intergenic
926176621 2:10598453-10598475 CTGTGGGAATACAGGGAATGTGG + Intronic
927008221 2:18873855-18873877 CTACAGGAATGCAGGAAAGAAGG + Intergenic
927080666 2:19626472-19626494 CTATGGTAAGGCTGGGGACAAGG - Intergenic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927388520 2:22564834-22564856 CTATCAGAAAGGAGGGAACAAGG + Intergenic
928035828 2:27822197-27822219 CTATGGCTAAGCAGGGAACAGGG + Intronic
928404626 2:31005092-31005114 CTAAGGGAATACAAGGAAAAGGG + Intronic
930267675 2:49219046-49219068 CTATAGGATTGCAGGGAGAAGGG + Intergenic
933096299 2:78186889-78186911 CTATGGAAATGTAGTAAACATGG - Intergenic
933846621 2:86332051-86332073 CCCTGGGAATACAGGGAAAAAGG - Intronic
935692020 2:105740586-105740608 TTCTGGGAATGGAGGGACCAAGG + Intergenic
937140077 2:119592585-119592607 ATTTGTGAATGTAGGGAACATGG - Intronic
937835930 2:126470219-126470241 CTTGGCGGATGCAGGGAACAGGG + Intergenic
940166596 2:150780473-150780495 CTGTGGCAAAGCAGGGAAAAAGG - Intergenic
940279340 2:151973563-151973585 CTTAGGCAACGCAGGGAACATGG - Intronic
943271757 2:185814215-185814237 CTGTGGGAAAGCAGGTAATAGGG + Intronic
943800038 2:192046038-192046060 CTATAGGATGGCAGGAAACATGG - Intronic
944324946 2:198393164-198393186 CTATTGGGATGGAGGGCACATGG + Intronic
944568912 2:201022659-201022681 ATATGGAAAGGCAGGGAATAGGG + Intronic
946537442 2:220647102-220647124 CAAGGGGAATGCAGAGAACCTGG - Intergenic
948745007 2:240084088-240084110 TTGTGGAAATGCAGAGAACATGG + Intergenic
1169204898 20:3733916-3733938 CTATGGGAATGCAGTGTTCTGGG - Intronic
1170119053 20:12892697-12892719 CTCTGGGAAGGAAGGGACCATGG - Intergenic
1170273642 20:14556984-14557006 CTATGGTAATGAAGACAACATGG + Intronic
1171442757 20:25178692-25178714 CGATGGGAATGCAGTGCTCAGGG + Intergenic
1172744636 20:37197159-37197181 CTATGGTGATGCAGGCAGCATGG + Intronic
1173747664 20:45450111-45450133 CATTGGGAATGCTGGGAGCAGGG + Intergenic
1176976245 21:15326162-15326184 CCTTGGGGATGCAGGGCACAGGG - Intergenic
1178730861 21:35101389-35101411 CAATAGGAATGAAGGCAACAAGG - Intronic
1179623394 21:42633287-42633309 CTCTGGGACTGCAGGTGACACGG + Intergenic
1180968787 22:19804114-19804136 CTAGGGGGCTGCAGGGACCAGGG - Intronic
1181017512 22:20079929-20079951 CGCGGGGAATGCCGGGAACAGGG - Intergenic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1182323755 22:29495886-29495908 CTCTGGGAATACAGAAAACAGGG + Intergenic
1183505073 22:38204119-38204141 CAATGGCAATGCAGGGCCCAGGG - Intronic
1183522091 22:38301314-38301336 CGAGGGGCAGGCAGGGAACATGG + Intronic
949658769 3:6253083-6253105 TGATGGGGATGCAGTGAACAGGG + Intergenic
949941307 3:9156900-9156922 ATTTGGGAATGAAGGGTACAGGG - Intronic
950185574 3:10943379-10943401 CTTTGGGAGAGCAGGGAACCAGG + Intergenic
950314796 3:11991803-11991825 CTCTGGGAATGCAGAGAAGGGGG + Intergenic
957419035 3:79944745-79944767 CAATGGGAATGCTGTGAAAAGGG + Intergenic
957877508 3:86167814-86167836 ATATGGGAATGTAGATAACAGGG + Intergenic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
962897346 3:139728312-139728334 CTGTGAGAAAGCAGGGAAAATGG + Intergenic
963043434 3:141085420-141085442 CTATGGGAATGGAAGCCACAAGG - Intronic
963052254 3:141152233-141152255 CTGTGGGAATGCAGGGAGCCTGG - Intergenic
965864678 3:173191511-173191533 CTATGGGAATCCAATGAATAAGG + Intergenic
966227495 3:177613728-177613750 CTGTGTGAATGCAGGTAACAGGG - Intergenic
966939704 3:184737890-184737912 CAATGGGAATACAGGGAGCGTGG - Intergenic
969045462 4:4333430-4333452 ATATGGGAATGCAGAGGATATGG + Intergenic
969546635 4:7834342-7834364 CTTTGGGGATTCAGGGAAAAAGG + Intronic
971284670 4:25276412-25276434 CTATGGGAAAGCATGAAGCAGGG - Intronic
971666976 4:29499955-29499977 CTGTGGGAATTCTGTGAACATGG - Intergenic
972591737 4:40494510-40494532 CTGTGGGAGGGCAAGGAACAAGG + Intronic
973050542 4:45590515-45590537 CTTTGGAAAAGCAGAGAACAAGG + Intergenic
973398797 4:49619978-49620000 CTAAGTCAATGAAGGGAACATGG + Intergenic
974349380 4:60724671-60724693 CTGGGGGAAAGCAGGGAATAAGG - Intergenic
980701737 4:136441807-136441829 CCTTGGGGATGCAGGGTACAGGG - Intergenic
980741714 4:136958405-136958427 TGATGGGAAAGCAGGGAATAAGG - Intergenic
983046941 4:162998894-162998916 CAATGGGAATGTATGGCACAGGG - Intergenic
983993986 4:174158954-174158976 CTATGGAAAAGCAGGGAGAAGGG + Intergenic
986238761 5:5937927-5937949 CTATTTGAAAGCAGGGAAGAGGG - Intergenic
989516675 5:42352063-42352085 CTATGGGAGTTCAGGGAAAGGGG + Intergenic
990887206 5:60608087-60608109 CAAGGGGAAAGCAGGGAAAAAGG + Intronic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
993258125 5:85619670-85619692 CTAGGGGAATGCAGTGACCTGGG + Intergenic
993893447 5:93502989-93503011 CTATGGGAAAGGAGAGAAAAGGG + Intergenic
994660613 5:102649297-102649319 GTCTGGGAAAGCAGGGAATAGGG + Intergenic
995385563 5:111585092-111585114 CTGTGAGAATGCAGGGAAATAGG + Intergenic
996021534 5:118595948-118595970 CTGTGTGAAGACAGGGAACATGG - Intergenic
996652200 5:125892629-125892651 CTATGGGAAGGAAAGGAAAAAGG + Intergenic
997689739 5:135819585-135819607 GGATGGGAATGGAGGGAAAATGG + Intergenic
998281515 5:140812700-140812722 CTTTGGGAATCCAAGGCACAAGG - Intronic
998368067 5:141644059-141644081 CTATGGGGGGGCAGGGAAAAGGG - Intronic
998778865 5:145633903-145633925 CTATGGGAATGCAGGGAACATGG - Intronic
1000836099 5:166156074-166156096 GTAGGGGAATTCAGGGAACCAGG + Intergenic
1001881236 5:175246044-175246066 ATGTGGGGATTCAGGGAACATGG + Intergenic
1002915296 6:1524003-1524025 CTGTGTGAATGCAGGGAAAGCGG + Intergenic
1003691331 6:8356820-8356842 CTAAGGAAATGCAGGGCTCATGG + Intergenic
1003824513 6:9938312-9938334 CTGCGGGAATGCAGAGAACTGGG - Intronic
1004065715 6:12241941-12241963 TTATGGGAATGCAGTAAAGATGG - Intergenic
1004594658 6:17087692-17087714 AAATGGGAATGCAGGCAGCAAGG - Intergenic
1005352353 6:24948975-24948997 CTAAGAGAAGTCAGGGAACAGGG - Intronic
1006089954 6:31622514-31622536 CTGGGGGAAAGGAGGGAACATGG + Intronic
1007246048 6:40463621-40463643 GCAGGGAAATGCAGGGAACATGG - Intronic
1009422020 6:63474066-63474088 CCATGGGAAATCAGGTAACATGG + Intergenic
1011913366 6:92470065-92470087 ATTGGGGAATGCAGGGAAGATGG + Intergenic
1012052634 6:94362622-94362644 CTCTGGGGATGCAGGGCACAGGG + Intergenic
1012563251 6:100613811-100613833 CTATGAGGATGCAGGGGAAAGGG - Intronic
1012620069 6:101333117-101333139 CTAAAGGAATGCAGAGAAGAAGG - Intergenic
1014759986 6:125345811-125345833 GTTTGGGAGAGCAGGGAACAGGG + Intergenic
1014931027 6:127336463-127336485 CTTTGGGAAAGCAGGGAAATAGG - Intronic
1015027842 6:128558391-128558413 CTCTTAGAATGCAGGGAACCTGG + Intergenic
1016640220 6:146339881-146339903 CTGTGGGAAGCCAGGGACCATGG + Intronic
1018960422 6:168443449-168443471 CTTGGGGAATGCAGCCAACAGGG - Intronic
1021097029 7:16547014-16547036 CCTTGGGGATGCAGGGCACAGGG - Intronic
1023897406 7:44445406-44445428 CTAGGGGAAGGGAGTGAACAGGG - Intronic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1025175366 7:56798178-56798200 CTTTGGGAAGGCAGGGTAGAAGG - Intergenic
1025696434 7:63778235-63778257 CTTTGGGAAGGCAGGGTAGAAGG + Intergenic
1025913214 7:65844545-65844567 CTTTGGGAAGGCAGGGTAGAAGG + Intergenic
1029056203 7:97745558-97745580 CTTTGGGAAGCCAGGGAAAAAGG + Intergenic
1029903599 7:104068238-104068260 CAATGGGAAGGCAGAGAGCAAGG + Intergenic
1030084663 7:105806133-105806155 AGATGGGAATGCAGGTTACATGG + Intronic
1031184589 7:118460482-118460504 CTGTGGGAAGGCAGGAAATAAGG - Intergenic
1034113301 7:148559386-148559408 CTATGGGGAAGAAGGGAATAGGG - Intergenic
1038373419 8:27014316-27014338 GTATGGCAATGCAGGGAAGGTGG + Intergenic
1040683519 8:49842509-49842531 CTATGGCACTTCAGGGATCATGG + Intergenic
1041073039 8:54143762-54143784 GTAAGGGAATGGAGGGAGCAGGG - Intronic
1041835120 8:62203173-62203195 CTTTGTGAATGCAGGGGCCAGGG + Intergenic
1042008813 8:64215330-64215352 TTTTGTGAATGCAGTGAACATGG - Intergenic
1043089361 8:75877736-75877758 ACATGGGAATACAGGCAACAAGG - Intergenic
1043276167 8:78396333-78396355 GTATGGAAATGCAAGGAACCTGG - Intergenic
1044537974 8:93379388-93379410 CTCTGGGAATGCAGGCGAAAGGG - Intergenic
1044900287 8:96936854-96936876 CTATGGGAATGGAGAAATCAAGG - Intronic
1046037977 8:108867102-108867124 CTATAGGAATTGAGGGAACATGG - Intergenic
1046649462 8:116821240-116821262 CTATGGAAATGCAAAGAACCAGG - Intronic
1047350106 8:124065562-124065584 CTAGGGGAATGCAGCAAACCTGG - Intronic
1047974165 8:130112949-130112971 CAAGGGGAATGCAGGAACCAGGG - Intronic
1048344602 8:133567251-133567273 CTCTGGGACAGCAAGGAACAAGG + Intronic
1048471011 8:134704133-134704155 CTCAGGTAATGCAGGGAAAAGGG - Intronic
1048709476 8:137192785-137192807 GTGTGGGAATGCAAGGAGCAAGG - Intergenic
1050013748 9:1211402-1211424 CTATGAGAATGGAGACAACAAGG - Intergenic
1051225746 9:14897370-14897392 CTATGGTAGAGCAAGGAACATGG - Intronic
1051226870 9:14908457-14908479 ACATGTGAAAGCAGGGAACATGG + Intronic
1056191195 9:84185794-84185816 TTCTGGGAAAGCAGGGAACGTGG + Intergenic
1056810263 9:89758346-89758368 CTGTGGAAACGCAGGGGACACGG - Intergenic
1057722616 9:97545125-97545147 CTCTGCAAATGCAGGGAACAGGG + Intronic
1060018418 9:120107377-120107399 GTTTGGGAATGCAGGGAGAAAGG + Intergenic
1060987329 9:127827187-127827209 CTATGGGAAGACAGGGAGAAAGG + Intronic
1061596938 9:131636918-131636940 TTTTTGGAATGAAGGGAACATGG + Intronic
1062687792 9:137824489-137824511 CTATGGAAATGCAAAGGACATGG - Intronic
1187677829 X:21735532-21735554 CTGTGTGATTACAGGGAACAAGG - Intronic
1188367328 X:29332569-29332591 CCATGGGAAATCAGGTAACATGG + Intronic
1188497129 X:30792755-30792777 CGATGGGAAGGCAAGGCACAAGG - Intergenic
1195740545 X:108060888-108060910 CCAGGGGTATGGAGGGAACAGGG - Intronic
1196050437 X:111298380-111298402 CCAGGTGAATGCAGGGAAAAGGG + Exonic
1197279578 X:124519307-124519329 TTACTGGAATGCAAGGAACATGG - Intronic
1197556347 X:127959690-127959712 CTTTGGGAATTCAGGGGATAAGG - Intergenic
1198015872 X:132610366-132610388 ATATAGGAATGAAGGGAAGAAGG + Intergenic
1198037857 X:132819710-132819732 CTCTGGGATGGCAGGGGACATGG - Intronic
1199719293 X:150530730-150530752 CTACGGGAATGCAGACAACTGGG - Intergenic
1200105517 X:153709949-153709971 CTATGGGTCAGCCGGGAACATGG + Intronic