ID: 998779986

View in Genome Browser
Species Human (GRCh38)
Location 5:145646130-145646152
Sequence CTGGGAGTATGGAACCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9991
Summary {0: 1, 1: 73, 2: 3008, 3: 4224, 4: 2685}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998779986_998779991 12 Left 998779986 5:145646130-145646152 CCAACTTGGTTCCATACTCCCAG 0: 1
1: 73
2: 3008
3: 4224
4: 2685
Right 998779991 5:145646165-145646187 ACACCATTCAAACGTAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998779986 Original CRISPR CTGGGAGTATGGAACCAAGT TGG (reversed) Intronic
Too many off-targets to display for this crispr