ID: 998779986 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:145646130-145646152 |
| Sequence | CTGGGAGTATGGAACCAAGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 9991 | |||
| Summary | {0: 1, 1: 73, 2: 3008, 3: 4224, 4: 2685} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 998779986_998779991 | 12 | Left | 998779986 | 5:145646130-145646152 | CCAACTTGGTTCCATACTCCCAG | 0: 1 1: 73 2: 3008 3: 4224 4: 2685 |
||
| Right | 998779991 | 5:145646165-145646187 | ACACCATTCAAACGTAGATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 998779986 | Original CRISPR | CTGGGAGTATGGAACCAAGT TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||