ID: 998781707

View in Genome Browser
Species Human (GRCh38)
Location 5:145664365-145664387
Sequence ACTAAGAAGCAGAATGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 636
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 596}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998781706_998781707 5 Left 998781706 5:145664337-145664359 CCATTTGAGCAAGCAAGAACAAG 0: 1
1: 0
2: 0
3: 17
4: 182
Right 998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG 0: 1
1: 0
2: 1
3: 38
4: 596
998781705_998781707 10 Left 998781705 5:145664332-145664354 CCTTTCCATTTGAGCAAGCAAGA 0: 1
1: 0
2: 0
3: 9
4: 155
Right 998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG 0: 1
1: 0
2: 1
3: 38
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998781707 Original CRISPR ACTAAGAAGCAGAATGAAGA AGG Intronic
900253941 1:1687075-1687097 AATAAAAAGAAGAAAGAAGATGG + Intronic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
901748673 1:11392141-11392163 AGAGAGGAGCAGAATGAAGAAGG - Intergenic
901909304 1:12441868-12441890 AAAAAGAAGCAAAATAAAGATGG - Intronic
901909404 1:12443516-12443538 AAAAAGAAGCAAAATAAAGATGG - Intronic
903296206 1:22344693-22344715 AATAAGAAGCAAAAAGAAGTGGG + Intergenic
903608749 1:24594319-24594341 ACTAAGAATCAAAATGCACAAGG - Intronic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
906025775 1:42672518-42672540 GCTAAGAAGGAGATAGAAGACGG + Intronic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906779844 1:48563435-48563457 AAAAAGAGGCAGAATGAAAATGG + Intronic
907770500 1:57457787-57457809 AGTAAGAAAGAGAAAGAAGATGG + Intronic
907843581 1:58181717-58181739 ACAAAGAAGGAGAAAGAAAATGG - Intronic
909172999 1:72318408-72318430 ACCAAGGAGCATAATGAAGCTGG - Intergenic
909489948 1:76215153-76215175 AGTAAGAATCAGAATTCAGAGGG + Intronic
909583826 1:77266890-77266912 ACAGGGAAGCAGAATGAAGAAGG + Intergenic
909710028 1:78638580-78638602 GCTCAAAAGCAGAATGGAGAGGG - Intronic
909981713 1:82110067-82110089 ACTAATAATCAGAAAGAATATGG + Intergenic
910039699 1:82834869-82834891 AGTGAGAAGCAGGAAGAAGAAGG - Intergenic
910525187 1:88169784-88169806 ACTAAAAATCAGGGTGAAGATGG - Intergenic
910526284 1:88182569-88182591 AATGAGAAGCAGAATGACAAAGG + Intergenic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
912112449 1:106359607-106359629 ACAAATAAGCAGAATTAAGATGG + Intergenic
912153983 1:106893245-106893267 ATTCACAAGCAGAATTAAGAAGG + Intergenic
913377619 1:118171157-118171179 ACTTAGAGGCAGACTGAATATGG + Intronic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914383875 1:147148364-147148386 ACTAAGGAACATAATGAAGCTGG + Intergenic
914960099 1:152197470-152197492 AAAAAGAAGAAGAAAGAAGAAGG - Intergenic
916567180 1:165991093-165991115 AATGAGGAGGAGAATGAAGAAGG + Intergenic
916851056 1:168704070-168704092 ACAAGGAAGCAGAATGATCAGGG + Intronic
917225844 1:172781535-172781557 AGGAAAAAGAAGAATGAAGAAGG - Intergenic
918236669 1:182586918-182586940 ACAGAGCAGCAGTATGAAGAAGG + Exonic
918350815 1:183653858-183653880 ACTAAGGAAAAGAATGGAGAAGG - Intronic
919000761 1:191828111-191828133 ACTAAGGAACATAATGAAGCTGG - Intergenic
919676623 1:200389894-200389916 AATGAGGAGCAGAATGATGATGG - Intergenic
920058035 1:203206744-203206766 TCTGAGATGCAGAATGAAAAAGG - Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
921530735 1:216279444-216279466 CCAAAGAAGCTGAATGTAGATGG - Intronic
921595447 1:217049297-217049319 TCCAAGAAGGAGAATGAAGCCGG + Intronic
921874706 1:220181426-220181448 ACAAAGAAGAACAAGGAAGATGG + Intronic
922898290 1:229117385-229117407 ACAAAGATGCAGGATGAAGATGG + Intergenic
923187944 1:231592084-231592106 AAAAAGCAGCAGAATGAATATGG - Intronic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
923931815 1:238708834-238708856 AGTAAAAAGCAGAAGGAAAATGG + Intergenic
924213786 1:241797957-241797979 ACTAAGTGACAGAAAGAAGATGG + Intronic
924553201 1:245097667-245097689 ACTATGAAGAAAAATGAAGCAGG + Intronic
924680571 1:246227631-246227653 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1063228446 10:4039682-4039704 AATAAGAAGAAGAAAGAGGAGGG - Intergenic
1064038117 10:11932312-11932334 ACTAATAAGCCTAATGATGATGG + Intronic
1064464945 10:15569548-15569570 AGTAAGAAGCAGACAGAGGATGG - Intronic
1064862586 10:19844347-19844369 ACCAAAAAGCTGAATGAAGCTGG + Intronic
1065043099 10:21717542-21717564 AGAAAGAAGAAGAAAGAAGAAGG - Intronic
1065333875 10:24634685-24634707 ACAAAGTAGCAAAATGATGAAGG - Intronic
1065808631 10:29420168-29420190 ACTGAGCAGCAGACTGAATACGG - Intergenic
1066508858 10:36073178-36073200 ACCAAGAAGCAGAAGACAGATGG + Intergenic
1066612694 10:37266337-37266359 ACTCTGAACCAGAAGGAAGAGGG - Intronic
1066935060 10:41818655-41818677 ACAAAGAAGCAGAGTCAAGATGG - Intergenic
1068438245 10:57018397-57018419 ACTCAGAAAGAGAATGAAAAGGG + Intergenic
1068446827 10:57135607-57135629 ACCAAGAAACATAATGAAGGAGG + Intergenic
1069295293 10:66836338-66836360 ACAAGGAAGCAGAATTAAGATGG - Intronic
1069372078 10:67758907-67758929 AGTAAGAAGAAGAATCAAGAAGG - Intergenic
1069473066 10:68710317-68710339 AAAAAGAAGAAGAAAGAAGAAGG - Intergenic
1070037194 10:72737918-72737940 ACTTAAAAGCAGAAAGAATACGG - Intronic
1070272315 10:74968135-74968157 TCTAAGAAGCACACTGAAGCGGG - Intronic
1070326479 10:75392822-75392844 ACTAAGAACCAGTATGAACTAGG + Intergenic
1070423182 10:76258252-76258274 ACTGAGACGAAGTATGAAGATGG - Intronic
1071230399 10:83579557-83579579 AAAAAGAACAAGAATGAAGAGGG + Intergenic
1071256004 10:83872247-83872269 ACAAAAAACCAGAATGAATAAGG - Intergenic
1071910365 10:90225011-90225033 TGAATGAAGCAGAATGAAGAAGG - Intergenic
1072252753 10:93594581-93594603 ATTAATAAGCAGAATTAGGATGG - Intronic
1072834011 10:98692080-98692102 ACTAAGAAAAAGAATGAAATGGG + Intronic
1073180886 10:101582529-101582551 ACTGAGAACCAGAATCTAGAGGG + Intronic
1074879841 10:117647327-117647349 ACTGAGAAGCAGCATGGACAGGG + Intergenic
1075282647 10:121153655-121153677 GCTAAGAAATAGTATGAAGAGGG + Intergenic
1075339285 10:121632739-121632761 AATAAAAATAAGAATGAAGAGGG + Intergenic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1078168218 11:8909376-8909398 AAAAAGAAGAAGAAGGAAGAAGG + Intronic
1078654448 11:13225353-13225375 ACTAAGAAGGAGAGTAGAGATGG + Intergenic
1078935075 11:15942654-15942676 AGGAAGAAGCAAAAGGAAGAAGG + Intergenic
1079307321 11:19334618-19334640 ACTTGGAGGCAGCATGAAGAGGG + Intergenic
1079645156 11:22853703-22853725 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1079743329 11:24092734-24092756 TATAAAAAGCAAAATGAAGAGGG + Intergenic
1079850423 11:25526425-25526447 TCAAAGAGGCAGAATGGAGAAGG + Intergenic
1079950116 11:26791388-26791410 TCTAAGTAGCAGAAAGAAAATGG + Intergenic
1080233091 11:30039931-30039953 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1081246495 11:40772456-40772478 AGTAAGAAGCAGAATGTATAAGG + Intronic
1084365746 11:68696727-68696749 ACTAAATAGCAGAATGTAGAGGG + Intergenic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1085741410 11:79080910-79080932 ACTAGGAAGCAGAGGGAAGAGGG + Intronic
1086096478 11:83054920-83054942 CCTCAGAAGCAGCAAGAAGATGG + Intronic
1086759950 11:90616208-90616230 ATGAAGAAGCAGCATGAACATGG - Intergenic
1087247681 11:95858829-95858851 ACTATGAAGCAGAATTCAGAGGG + Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087579492 11:100034001-100034023 AGTAAGATACAGAATGAAGGTGG - Intronic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1087970609 11:104477258-104477280 ACTAAAGAGCACAATAAAGAAGG - Intergenic
1088201856 11:107345112-107345134 ACTAAAAAACAGAATGAAATAGG + Intronic
1089028709 11:115299701-115299723 CTTAAGAAGCAGAAGCAAGACGG + Intronic
1089064970 11:115655782-115655804 ACCACGAGGCAGAATGAAGCAGG - Intergenic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1089473709 11:118741507-118741529 TCTCAAAAGCAGAATGAAGCTGG + Intergenic
1089644669 11:119870891-119870913 TCTAAGAAGGAGAATAAAGAAGG + Intergenic
1089999024 11:122937720-122937742 ACGAAGGAGAAGAGTGAAGAGGG - Intronic
1090239064 11:125169329-125169351 ACTGAGAAGCAGAATTTAGAGGG + Intronic
1090464631 11:126923312-126923334 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090464639 11:126923369-126923391 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1091714113 12:2764807-2764829 GCTAAAGAGCAGAAGGAAGAAGG + Intergenic
1091857185 12:3749380-3749402 ACTCAGAGGCAGCATGAAGCAGG - Intronic
1093393279 12:18649874-18649896 ACTAAGAAGGAGAAACAAAAAGG - Intergenic
1093636849 12:21480854-21480876 ACTTAGAAACTTAATGAAGAGGG - Intronic
1093902829 12:24655279-24655301 ACTAATAATCAGAATGTATAAGG - Intergenic
1094789681 12:33897602-33897624 ACTAATAACCAGAATCTAGAAGG + Intergenic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095740688 12:45603495-45603517 AAAAAGAAGAAGAAGGAAGAAGG - Intergenic
1095815413 12:46416799-46416821 AATAAGAAGATGAATGAGGAAGG - Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1097201040 12:57278974-57278996 ACTAATAAGCAGAGGGATGAGGG + Intronic
1097409329 12:59231141-59231163 ACTAAGAGGAAGAAAGAAAAAGG - Intergenic
1097431894 12:59519212-59519234 ACCAAGAAACATAATGAAGCTGG - Intergenic
1097437421 12:59568346-59568368 ACTGAGAAGCAGAATGAGAGGGG + Intergenic
1097602062 12:61705446-61705468 CCAATGAAGCAGAATGAAAAAGG - Intergenic
1098726108 12:73969825-73969847 AGTAAGAAGGAGGAAGAAGAGGG + Intergenic
1098941697 12:76544267-76544289 ATTAAGGATCAAAATGAAGAAGG - Intronic
1098954128 12:76670955-76670977 TCTAAGAAGAGGAATGCAGATGG + Intergenic
1099139144 12:78948541-78948563 ATTAATAAGCAGAATGAATATGG - Intronic
1099826743 12:87785329-87785351 ACTGTGAAGCACAAAGAAGAGGG - Intergenic
1099913068 12:88857468-88857490 GCTAAGAAGCAAAATCCAGAAGG - Intergenic
1100952377 12:99865620-99865642 AGTAAGAAGCAGAGGGAAAAGGG + Intronic
1100997483 12:100318250-100318272 AGAAAGAAGCAGAAAGATGAAGG - Intronic
1101257521 12:102993131-102993153 ACTAAGAAGCAGAAGCTAGGAGG + Intergenic
1101407256 12:104439447-104439469 ACTAAGGGGCAGAAGGCAGAAGG - Intergenic
1101794110 12:107957040-107957062 AATGAGAAGAAGAAAGAAGAAGG - Intergenic
1102233195 12:111277549-111277571 GCTCAGAAGCAAAATGAAGCAGG - Intronic
1103680663 12:122690966-122690988 AATAACAAGCAGAAAGAGGAAGG - Intergenic
1105554156 13:21429871-21429893 ACTGAACAGCAGAATGGAGAGGG - Intronic
1105574087 13:21633615-21633637 ATTAAGAAGCACAATGAAACAGG + Intergenic
1105636215 13:22217995-22218017 ACACAGCAGCAGAATGCAGAGGG + Intergenic
1106949763 13:34870340-34870362 AATAAGGAGCTGAATGGAGAGGG - Intergenic
1107026445 13:35806641-35806663 AGTTAGAAACTGAATGAAGAAGG - Intronic
1107287249 13:38808018-38808040 ACTAAAATGAAGGATGAAGAGGG - Intronic
1107405586 13:40109576-40109598 ACGAAGAAGGAGAAGGGAGAGGG + Intergenic
1108187557 13:47903286-47903308 TCTCTGAAGCTGAATGAAGAAGG + Intergenic
1108878736 13:55082423-55082445 ATTAATAACCAGAATGCAGAAGG - Intergenic
1108903859 13:55446684-55446706 ACCAAGAAACATAATGAAGCTGG + Intergenic
1109192544 13:59342752-59342774 ACAAAGAAGCAAAATGAATGTGG + Intergenic
1109268272 13:60225448-60225470 GCTAAGAAGGAAAATGAAGCTGG - Intergenic
1109362170 13:61307847-61307869 ACTAAGACTGAAAATGAAGAAGG - Intergenic
1110036399 13:70690797-70690819 ACTCAGTAGCAGAAGGAAGAGGG - Intergenic
1110081673 13:71321421-71321443 ATAAAGAAGGAGAAAGAAGATGG + Intergenic
1110256405 13:73438568-73438590 GCTAAGTGGCAGAATCAAGAGGG + Intergenic
1110557457 13:76876625-76876647 CCCAAAAAGCAGAATGGAGAAGG + Intergenic
1110590091 13:77246478-77246500 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1111994540 13:95151522-95151544 AGAAGGAAGAAGAATGAAGAAGG + Intronic
1111997399 13:95178453-95178475 GCTAAGAAGGAGAAGGAAGCTGG + Intronic
1112171823 13:96980590-96980612 CATAAGAAGAAGAGTGAAGATGG + Intergenic
1113032396 13:106008584-106008606 GCTAAGAACCACAATTAAGATGG - Intergenic
1113432468 13:110262529-110262551 AATAAAAAGTAGAATTAAGAGGG - Intronic
1113985199 13:114309211-114309233 ACTCAGACACAGAATGAACAAGG - Intergenic
1115116064 14:29881539-29881561 AATAAAAAGCAAAATGGAGAAGG - Intronic
1115438637 14:33406344-33406366 ACTAAGAAGCAGAGAGATGCAGG + Intronic
1115920814 14:38371381-38371403 ACTAAGATGAAGAATGAGAATGG + Intergenic
1118070433 14:62241174-62241196 ACTACTAAGCAGAATAAAGAAGG + Intergenic
1118143863 14:63114991-63115013 ACTAAAAAGCATAATTAATAAGG + Intergenic
1118569033 14:67174020-67174042 ACAATGAAAAAGAATGAAGAAGG + Intronic
1118571225 14:67197441-67197463 AGTAAGTAGAAGAAGGAAGAGGG - Intronic
1119929322 14:78529565-78529587 ACAAAGAAGTAGAATCAAGGAGG - Intronic
1120111350 14:80561034-80561056 ACTTAGAAGCAGAATGAACTTGG + Intronic
1121878400 14:97476533-97476555 ACTAAAAAGCAGAAAGAAGAAGG - Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1122392799 14:101401846-101401868 ACGAAGAAGAAGAGGGAAGAGGG - Intergenic
1124185384 15:27521734-27521756 ACTTAAGAGCAGATTGAAGATGG + Intronic
1125283485 15:38068726-38068748 AGTAACAAGCAGCATGAAAATGG + Intergenic
1125581218 15:40787408-40787430 ACTGAGGAGCAGAAGGAAGTAGG + Intronic
1126041526 15:44595662-44595684 ACCAAGAAGCAGACAGAAGGGGG + Intronic
1126262333 15:46708428-46708450 ATTTGTAAGCAGAATGAAGATGG - Intergenic
1126368615 15:47922208-47922230 ACTTAAGAGCAGAATGCAGATGG - Intergenic
1126392541 15:48175271-48175293 ACTCAGAAGCAGAGAGTAGAAGG + Intronic
1126567365 15:50114070-50114092 ACCAAGAAGGAAAATGAACAGGG - Intronic
1128095609 15:64952253-64952275 AAAAAGAAGGAGAAGGAAGAAGG - Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095628 15:64952432-64952454 ACTAAGAAGAAGAAAGGAGGAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095653 15:64952663-64952685 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1128095733 15:64953538-64953560 AGAAAGAAGGAGAAGGAAGAAGG - Intronic
1128352446 15:66900149-66900171 ACTGAGGATAAGAATGAAGAAGG - Intergenic
1131224403 15:90611985-90612007 GATAAGAAGGAGAAGGAAGATGG - Intronic
1131544079 15:93301164-93301186 ACTAAGTACCAGAGTGCAGAAGG - Intergenic
1132066434 15:98734990-98735012 ACCAGGAAGCAGAAATAAGAAGG - Intronic
1134054495 16:11161081-11161103 ACAAAAAAGCAAAAAGAAGAGGG - Intronic
1134374987 16:13663807-13663829 ACAAAGAAGCAGAATGTGAAAGG - Intergenic
1135216353 16:20574929-20574951 ACTAAGGAACATAATGAAGCTGG - Intronic
1136083639 16:27869010-27869032 ACTAAGAGGCAGAGGGAGGAGGG + Intronic
1137346085 16:47661332-47661354 ACCAATAAGAAGAATCAAGAAGG + Intronic
1137402748 16:48166576-48166598 CGTAAAAAGCAGAATGAAGATGG + Intergenic
1140526519 16:75627426-75627448 ACTAAGAAGAAAAATGGAGCAGG - Intergenic
1140851666 16:78940534-78940556 ATTAAGAAGCAGATGGAACACGG - Intronic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1141961580 16:87412656-87412678 ACCAAGAAGCAGCATGAAAGTGG - Exonic
1141984615 16:87571746-87571768 ACTCAGAAGAAAAATGAAGCTGG - Intergenic
1142545126 17:695928-695950 GCTAAGCAGCAGAATGCAGCTGG + Intronic
1143297314 17:5880970-5880992 ACCAGGGAGCAGAAAGAAGACGG - Intronic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143556066 17:7661384-7661406 AATAAGCAACAGAATGGAGAGGG - Intergenic
1143656944 17:8300443-8300465 AGGAAGAAGAAGAAAGAAGAAGG - Intergenic
1143778413 17:9215164-9215186 ACTATGAAGTAGAATGAGGTGGG - Intronic
1143794703 17:9327301-9327323 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1145243139 17:21251322-21251344 ACTCAGAGACAGAAAGAAGAGGG - Intronic
1145824648 17:27867633-27867655 CTTCAGAAGCAAAATGAAGAAGG - Intronic
1145894116 17:28442354-28442376 AGTAAAAAGTAGAATCAAGATGG + Intergenic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146320577 17:31843418-31843440 ACTAGGAGGCAGAATCCAGATGG + Intergenic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1147412573 17:40264410-40264432 ACTAAGGAGCCGAGTGAAGTAGG + Intronic
1147490297 17:40859769-40859791 TCAAAGAAGCAGAAGGGAGAGGG - Intergenic
1149585474 17:57783326-57783348 ACTCTGATGCAGAATGAGGAAGG + Intergenic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1150192053 17:63253320-63253342 ATTAATAAGCAGAATGTATAAGG - Intronic
1150316590 17:64174377-64174399 ACTAGTAAGCAGAATGGGGAGGG + Intronic
1152053894 17:78006602-78006624 AGAAAGAAGAAGAAGGAAGAAGG - Intronic
1152324268 17:79626525-79626547 ACAAAAAAGGAGAATGCAGATGG - Intergenic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153231459 18:2940793-2940815 ACAAACAATCAAAATGAAGAGGG + Intronic
1153242262 18:3041754-3041776 ACAAACAAGAAGAATGAAGCTGG + Intergenic
1153485879 18:5597225-5597247 TCTGAGAAGCAGAATGACTAAGG - Intronic
1153559267 18:6354541-6354563 ACTAATAACCAGAATAAATAAGG + Intronic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1154384699 18:13882460-13882482 TCTAAGAAACAAAATGAAGATGG - Exonic
1155680998 18:28485660-28485682 ACTAGAAGGCAGAATAAAGAAGG + Intergenic
1156011072 18:32498606-32498628 AGTCAGAAACAAAATGAAGATGG - Intergenic
1156022509 18:32616278-32616300 ACCAAGAAGCGGAATTGAGAAGG + Intergenic
1156083868 18:33375883-33375905 ACTGAGAAGCATAAGGCAGAAGG + Intronic
1156738638 18:40296307-40296329 ACTATGAAGCCTAATGGAGAAGG + Intergenic
1156961617 18:43038768-43038790 CCTAAGAAGAAAAAAGAAGAGGG - Intronic
1157229898 18:45906022-45906044 ATTAAGAAGAGGACTGAAGATGG - Intronic
1157511201 18:48276188-48276210 AATGAGAAGAGGAATGAAGAGGG - Intronic
1157989714 18:52480052-52480074 CCTAAGACTCAGAATGATGAAGG + Intronic
1158076806 18:53539766-53539788 ACTAAGCAGAAGAAGTAAGAAGG - Intergenic
1158632859 18:59131570-59131592 ATCACAAAGCAGAATGAAGAAGG + Intergenic
1159359831 18:67385697-67385719 GATAAGAGACAGAATGAAGAGGG - Intergenic
1160591198 18:79945562-79945584 ACTAAGAGGCAAACAGAAGAAGG + Intronic
1160950837 19:1666518-1666540 AATAAGGAGAAGAAGGAAGAAGG - Intergenic
1162024139 19:7884318-7884340 AAAAAAAAGAAGAATGAAGAAGG + Intergenic
1163387239 19:17007372-17007394 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1163692333 19:18744586-18744608 AGTCAGAGGCAGAATGAAGCGGG - Intronic
1164458150 19:28426360-28426382 ACAAACAAGCAAAAAGAAGATGG + Intergenic
1164965989 19:32484520-32484542 ACTCAGAAGCAAAATCAAGTGGG - Exonic
1166096115 19:40540380-40540402 ATTAAAAAGCAGCATGGAGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166920465 19:46225994-46226016 TAAAAGAAGAAGAATGAAGAAGG + Intergenic
1167024790 19:46907449-46907471 GCTAAGAAACAGAATGAATGGGG - Intergenic
925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG + Intronic
925518296 2:4709572-4709594 ACTCAGAAGCAGAGAGTAGAGGG + Intergenic
926874392 2:17458518-17458540 AGGAAGAAGCATTATGAAGATGG + Intergenic
927286343 2:21360860-21360882 ACTAAGATGCATAAAGAAAAGGG - Intergenic
927310123 2:21620972-21620994 AGGAAGAAGCAGAATTAAGCAGG - Intergenic
927587951 2:24326366-24326388 TGGAAGAAGCAGAATAAAGAAGG + Intronic
927624078 2:24694685-24694707 ACTCAAAAACAGAATGAAGAAGG - Intronic
927719674 2:25374552-25374574 AGTAGGAAGCAGAGGGAAGACGG + Intergenic
927746379 2:25625688-25625710 ACTCAGAAGCAGAAGGTACAAGG - Intronic
928118368 2:28564248-28564270 AATAAGAAGGTGAATGAAGCTGG + Intronic
928197086 2:29223798-29223820 TCCAAGAAGCAGACTGGAGATGG + Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928662437 2:33516863-33516885 ACTAAGATGTAAAATGAAGCAGG + Intronic
929223310 2:39487483-39487505 ACTAGGAAACAAAGTGAAGAAGG - Intergenic
930675091 2:54191805-54191827 GCTAAGAAGAAAAATGAAGCAGG - Intronic
931131425 2:59340882-59340904 AGTAAGAAGCAGAATGAGACAGG + Intergenic
932025899 2:68132298-68132320 AATCAGAAGCAGAATGGAAAGGG + Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
933061375 2:77741041-77741063 ACTAAGAAACATTATGAAAAGGG - Intergenic
933344976 2:81071855-81071877 ACCCAGTAGCAGAATGGAGAGGG + Intergenic
935311901 2:101792627-101792649 AATAAGAAGAAGAAAGAAGAAGG - Intronic
935449526 2:103192635-103192657 AATATAAAACAGAATGAAGAAGG + Intergenic
936768101 2:115878048-115878070 AATAAGAAGTAGAAGGAAAAAGG - Intergenic
936984704 2:118297877-118297899 ACGAAGAGGTAGAAGGAAGAAGG - Intergenic
937327125 2:120996723-120996745 ACGAAGAAGAAGAAAGAAGAAGG - Intergenic
937337328 2:121070065-121070087 AGCAGGAAGTAGAATGAAGAAGG + Intergenic
937519570 2:122695647-122695669 TTTAAGAAGCAAAGTGAAGAAGG - Intergenic
937740841 2:125351335-125351357 ACTGAGAAGCATAGAGAAGAGGG + Intergenic
937745335 2:125405527-125405549 ATTAATAAGCAGAATGTATACGG - Intergenic
938899006 2:135782489-135782511 ACTAAGAAACACAATGGAAATGG + Intronic
939140716 2:138351481-138351503 ACCAAGAAAGAGAAAGAAGAGGG + Intergenic
939994448 2:148907090-148907112 ACTGAGAAGGACAATGAAGGTGG + Intronic
940261156 2:151780932-151780954 GGTAAGAAGAAGAAAGAAGAAGG + Intergenic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942766198 2:179460161-179460183 ACTAAGAAGAAAAATAAAGCTGG + Intronic
943202843 2:184851370-184851392 ACTCAGAAGCAGAAAGAGAATGG - Intronic
943352227 2:186809108-186809130 TATAAGAAGCATAAAGAAGAGGG + Intergenic
944955753 2:204806751-204806773 ATTAAGAACCAGAATGTATAAGG + Intronic
945823946 2:214697780-214697802 ACGAAGATGCAGGATAAAGAAGG + Intergenic
945946817 2:216002760-216002782 ACAAAGAAGGAGAATGGGGAGGG - Intronic
946528243 2:220542943-220542965 ACCAAGAAACATAATGAAGCTGG - Intergenic
946687399 2:222284200-222284222 ACAATGAAGCAGGCTGAAGAGGG + Intronic
946758247 2:222967855-222967877 ACTCAGAAACAGAATAATGAAGG - Intergenic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
947340630 2:229134990-229135012 ACAAAGAAGAAAAACGAAGATGG + Intronic
948014509 2:234677084-234677106 ACTCAGATGCAGACTGCAGATGG - Intergenic
948396068 2:237646082-237646104 ACAAAGAAGTAAAATGAAAAGGG - Intronic
948617010 2:239205662-239205684 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1168863699 20:1065258-1065280 ACTAAGAAGAAAAATAAAGCAGG - Intergenic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169294857 20:4386286-4386308 GCTCAACAGCAGAATGAAGAGGG + Intergenic
1169352834 20:4883418-4883440 ACTTAGCAGCAATATGAAGAGGG - Intronic
1169760657 20:9089385-9089407 ACTTAAAAGCACAAAGAAGAAGG + Intronic
1169793021 20:9431442-9431464 AATTAAAAGCAGAATTAAGAGGG - Intronic
1169825464 20:9763591-9763613 ATTAAGCAACAGAATGAAGTTGG + Intronic
1170099287 20:12680977-12680999 CCTCAGAGACAGAATGAAGATGG + Intergenic
1171079399 20:22162943-22162965 ACTATGCAGCAGCATGAAGCGGG - Intergenic
1173151633 20:40571211-40571233 ACCAGTAAGCAGAATGAACATGG - Intergenic
1173301798 20:41810094-41810116 ACTGAAAAGTAGAAAGAAGAAGG + Intergenic
1173327522 20:42047421-42047443 TGTAACAAGCTGAATGAAGAGGG - Intergenic
1173953489 20:47011794-47011816 GCTAAAAAGAAGAATGAAGCAGG - Intronic
1174269686 20:49358714-49358736 GCTAAGAAGAAAAATGAAGTAGG - Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1176936815 21:14876865-14876887 ACAAAGAAGAAGGAAGAAGAAGG - Intergenic
1177058376 21:16338255-16338277 ACTCAGAAGCAGAATTGATAGGG + Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177928615 21:27250628-27250650 AATTAGAAGCAGAATAAATAGGG + Intergenic
1178816406 21:35933966-35933988 ACTTAGAAGGAGAAGGAAGGAGG + Intronic
1179081847 21:38178699-38178721 AGAAAGAAGAAGAAAGAAGAAGG + Intronic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1180857556 22:19058003-19058025 TCCAAGAAGCAGAATAATGAAGG + Intronic
1182910190 22:33977587-33977609 AAAGTGAAGCAGAATGAAGATGG - Intergenic
1183680407 22:39325417-39325439 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184952452 22:47853625-47853647 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
949192342 3:1265441-1265463 AGTAAGAACCAGGATGGAGAAGG - Intronic
949369631 3:3320102-3320124 ACTAACATGCAGAAAGAAGGTGG - Intergenic
950417011 3:12874534-12874556 ACCTAGAAGAGGAATGAAGATGG - Intergenic
951532461 3:23710530-23710552 ACTAAGCAGCTGGATGAAAATGG + Intergenic
951951279 3:28201978-28202000 AGTAAGAGGGAAAATGAAGAGGG - Intergenic
952065711 3:29567480-29567502 ATTAAGAAGGATAATGCAGAGGG - Intronic
952069535 3:29617468-29617490 ACTAGGAAGGAGCATGAGGAAGG + Intronic
952265529 3:31782553-31782575 ACTAATATGCAGAATGCATAAGG + Intronic
952588356 3:34920506-34920528 ATTAAGAAGGAGAATGAGAATGG - Intergenic
952629134 3:35443466-35443488 ACTAACAATCAGATTGACGATGG + Intergenic
952773531 3:37023025-37023047 TCTAAGAAGCAGAAAGATGGTGG - Intronic
953173567 3:40529266-40529288 AGTGAGAAGTAGAAGGAAGAAGG - Intronic
954994507 3:54869355-54869377 TTAAAGAAGCAGAATTAAGAAGG + Intronic
955088292 3:55724353-55724375 GCTAAAAAGCAGAATAAAGAAGG - Intronic
955117601 3:56021274-56021296 TCTAGGAGGCAGAAGGAAGAAGG + Intronic
955179641 3:56655241-56655263 ACTAAGAAGTTGAATAAAAATGG - Intronic
955307444 3:57848500-57848522 AGGAAGAAGAAGAAAGAAGAAGG - Intronic
955565539 3:60240628-60240650 ACAAAGAAAGAGAAGGAAGAGGG + Intronic
956203213 3:66728976-66728998 ACAAAAAAGTTGAATGAAGATGG - Intergenic
956376503 3:68618927-68618949 ACAAAGCAGCAGAAAGATGAAGG - Intergenic
956662384 3:71611992-71612014 ACTTAGAAGCTTAATAAAGATGG + Intergenic
956801966 3:72767729-72767751 ACTAAAAATAAGAATGAAAAAGG + Intronic
956913778 3:73849408-73849430 GCTAAGAAGCATCATGGAGAGGG + Intergenic
956945078 3:74212287-74212309 AAAAAGAAGTAGCATGAAGATGG - Intergenic
957745367 3:84334058-84334080 ATTAATAAGCAGAATAAATAAGG + Intergenic
957745380 3:84334272-84334294 ACTAATAACCAGAATAAAAAAGG - Intergenic
957757029 3:84503484-84503506 AAGAAGAAGCAGAGTGAAGGTGG - Intergenic
957867783 3:86046783-86046805 ACTAATAAGCACAATGAGGGGGG - Intronic
958121838 3:89300489-89300511 ACTAATAAGCAGAGAGAAAATGG + Intronic
958255887 3:91324414-91324436 AAAAAGAAGAAGAAGGAAGAAGG + Intergenic
958734587 3:97993825-97993847 ACAAAGAAGTAAAAGGAAGAGGG - Intronic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
959931672 3:111990972-111990994 ACTGAAAAGAAAAATGAAGAGGG - Intronic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960301855 3:116012098-116012120 ACTAAGAAACAGGATGCAAAAGG - Intronic
961602239 3:128071203-128071225 ACTCAGCAGCAGAACCAAGATGG + Exonic
962508369 3:136072036-136072058 GCTAAGAAGAAAAATGAAGCAGG - Intronic
963738417 3:149048873-149048895 ACTTAGAATCAGAAAGAAGATGG - Exonic
964312064 3:155404381-155404403 ACTAAGATGGAGTATGAAAATGG - Intronic
964322570 3:155513532-155513554 GACAAGAAGCAGAATCAAGATGG + Intronic
965050327 3:163638615-163638637 ACCAAGAAACATAATGAAGTTGG - Intergenic
965783851 3:172315983-172316005 AAAAAGAAGAAGAAAGAAGAAGG - Intronic
966169218 3:177059099-177059121 ACTAAAAGGCAGACTGAAGGCGG + Intronic
966632395 3:182092721-182092743 CCAAAGAAGCAAAATGCAGAAGG - Intergenic
966759767 3:183407550-183407572 AAAAAGAAGCAGAAGAAAGAGGG - Intronic
967032805 3:185623976-185623998 ACTAAAAAGCAAAACAAAGAAGG - Exonic
967140822 3:186558090-186558112 ACTAAGGAGCATCAAGAAGATGG - Intronic
967216058 3:187211605-187211627 ACTAAGAAGAAGAACAAAGTAGG + Intergenic
967217741 3:187224688-187224710 ACCACAAAGCAGAATGTAGAAGG - Intronic
967222492 3:187259205-187259227 GCAAATAAGCAGAATGAACAAGG - Intronic
967581052 3:191155278-191155300 ACTAAGAAGAAGAAAGAATCTGG - Intergenic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
970197736 4:13569206-13569228 ACAGAGAAGAGGAATGAAGAGGG + Exonic
970898772 4:21134212-21134234 ACTAAGAAGGAGGAAGAGGAGGG - Intronic
971053041 4:22882555-22882577 ACTAGGAAGAGGAATGTAGAAGG - Intergenic
971586761 4:28414512-28414534 AATAAGAAGAAGAAAGAAGGGGG - Intergenic
971586764 4:28414515-28414537 ACTAATAAGAAGAAGAAAGAAGG - Intergenic
971825096 4:31610899-31610921 AATAAGGAATAGAATGAAGAAGG - Intergenic
973057171 4:45675225-45675247 ACTAAGAAACAAAATGATCATGG - Intergenic
973885773 4:55319417-55319439 ACTAAGAAGAAAAAGGAGGAGGG + Intergenic
975258686 4:72270658-72270680 ACCAAGAAGGAGAATACAGAAGG + Intergenic
975322103 4:73020313-73020335 ACTAAGAGGCAGAATGCAATAGG - Intergenic
975708073 4:77130339-77130361 ACTAATAACCAGAATGTATAAGG - Intergenic
975760335 4:77613891-77613913 ACTGAGAAACTGAATGAAGGAGG + Intergenic
976423086 4:84868233-84868255 ATTAAGAAGAAGAAAGAAAAAGG - Intronic
976633843 4:87267529-87267551 AATAAGAAGGAGAAGGGAGATGG - Intergenic
976816372 4:89151864-89151886 ACTAAGAAACAGAAAAAAAAAGG - Intergenic
977462968 4:97348615-97348637 ACTAAGAAGTAGAATAACAAAGG + Intronic
978223110 4:106301390-106301412 GTTTAGAAGCAGAGTGAAGATGG - Intronic
978468815 4:109038947-109038969 ACTGAGATGGAGAATAAAGATGG - Intronic
978668532 4:111216467-111216489 ACTAAAACGAAGAATGAGGATGG - Intergenic
979155645 4:117386091-117386113 GCTAAGAATGAGAATAAAGAGGG + Intergenic
979279943 4:118855716-118855738 ACTAAGAAACTGATTGAAGTAGG + Intronic
979435411 4:120683007-120683029 ACCAAGAAGAGCAATGAAGAAGG - Intergenic
979557124 4:122061856-122061878 GCTGAGAAGGAGAAAGAAGAGGG - Intergenic
979585232 4:122407729-122407751 TCTAAGAAGCAAAATTAAAAAGG - Intronic
979768372 4:124490939-124490961 AATAAGAAGAAGGAAGAAGAAGG + Intergenic
979997884 4:127454395-127454417 ACCAATAGGCAGAATGCAGACGG + Intergenic
980213728 4:129823431-129823453 ACTAAGTTCCATAATGAAGAAGG + Intergenic
981020618 4:140024192-140024214 AGTAAGCAGCAGAGTCAAGATGG + Intronic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
982847409 4:160271326-160271348 ACCAAGAAACATAATGAAGCAGG + Intergenic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
984128667 4:175844888-175844910 CCTAAGAAGAGGGATGAAGAGGG + Intronic
984351739 4:178603183-178603205 ATAAGGAATCAGAATGAAGATGG - Intergenic
984529021 4:180892838-180892860 ATTAATAAGCAAAATGAATATGG + Intergenic
984836901 4:184030772-184030794 ACTATGAAGTAGGATTAAGAGGG + Intergenic
985262983 4:188132004-188132026 ACTCAGAAGCAGAAAGTAGAAGG - Intergenic
985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG + Intergenic
986345352 5:6829894-6829916 CCTGAAAAGCAGAATGGAGATGG - Intergenic
987445397 5:18011510-18011532 GGAAAGAAGCAGCATGAAGAAGG + Intergenic
988062183 5:26185693-26185715 ACTAAGTTGAAGAATGAATAAGG + Intergenic
988089614 5:26519699-26519721 AGAAAGAAGGAGAAGGAAGAAGG + Intergenic
988307461 5:29511216-29511238 ATTAAGAATAAGAATAAAGATGG - Intergenic
988406489 5:30829972-30829994 ACAAATGAGCATAATGAAGACGG + Intergenic
988632089 5:32942416-32942438 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
989661426 5:43802486-43802508 ACTAACCTGCAGAATGAGGAAGG + Intergenic
989775414 5:45200774-45200796 GCTAAGAATGAGAATGAATATGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
991203204 5:64018284-64018306 TCTAAGAATCAGTATGTAGAAGG - Intergenic
991472619 5:66985169-66985191 TCAAAGAAGCGGAATGAAGGAGG + Intronic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
993138115 5:83996370-83996392 ACTGAGCAGCAGAAGGAACAAGG + Intronic
993724410 5:91351846-91351868 ACTAAGGAGCATAAGGCAGAAGG - Intergenic
994415584 5:99466270-99466292 AATATGAAGCACAATGAAGTAGG - Intergenic
994913679 5:105945617-105945639 AAAAAGAAGAAGAAAGAAGAGGG + Intergenic
994956669 5:106541734-106541756 AATAAGAAGTAGGAGGAAGAGGG - Intergenic
995213863 5:109572395-109572417 AATAAGAAGAAGAAAAAAGAAGG + Intergenic
996119909 5:119659761-119659783 AATAAGAAACAATATGAAGAAGG + Intergenic
996804219 5:127436829-127436851 GCTAAGAAGAAATATGAAGATGG - Intronic
996998131 5:129724481-129724503 ACTGAGAAGCATAAGGCAGAAGG + Intronic
997675042 5:135706674-135706696 ACCAAGATGCAGTGTGAAGAGGG + Intergenic
998290731 5:140911593-140911615 ACTAAGGAACATAATGAAGTTGG - Intronic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
999125001 5:149240089-149240111 ACTGAGAAGCAGCAGGAAGGTGG + Intronic
999291184 5:150427597-150427619 ACCAAGAAGGAGAATGGGGAAGG - Intergenic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
999504868 5:152184170-152184192 AGAAAGAAAAAGAATGAAGAGGG + Intergenic
999769603 5:154765361-154765383 ACTAAGAAGAAAAATGAAGCAGG - Intronic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1000427407 5:161108233-161108255 ACTAGGATACAGAATGAAGTAGG + Intergenic
1000831982 5:166113583-166113605 ACTTAGAAACAGAAGGATGAAGG + Intergenic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1003096990 6:3149957-3149979 TAGAAGAAGCAGAATGAAAAAGG + Intronic
1003673776 6:8183708-8183730 ACTTAGAGGCAGAGGGAAGATGG + Intergenic
1005569661 6:27132671-27132693 ACTAAGGCGCAGAAGAAAGACGG - Exonic
1007590920 6:43020631-43020653 AATAAGAGACAGAAAGAAGAGGG - Intronic
1007793202 6:44325783-44325805 ACTATGAAGGGGAAGGAAGAAGG + Intronic
1008007814 6:46430526-46430548 GCTTAGGAGGAGAATGAAGAGGG + Intronic
1008140867 6:47830622-47830644 AATAAGTAGCAGAATGAACCAGG + Intronic
1008456343 6:51715319-51715341 AGGAAGAAGCATAATGAAGGAGG - Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009195268 6:60677042-60677064 TCTAAGAAGCATAGTGAAGAAGG - Intergenic
1009291324 6:61886382-61886404 ATTTAGAAGCAGAGAGAAGAGGG - Intronic
1009961464 6:70527764-70527786 AAGAAGGAGCAGAACGAAGAGGG - Intronic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010954724 6:82076988-82077010 AATAGCAAGCAAAATGAAGAAGG - Intergenic
1011618422 6:89219493-89219515 AATAACAAGGAGAAGGAAGATGG + Intronic
1012639998 6:101598234-101598256 ACTAGGAAGAAGATTGAAAAGGG - Intronic
1013342154 6:109225423-109225445 TCTAAGTAGCAGGATGGAGAAGG + Intergenic
1013799726 6:113929020-113929042 AATAATAAGCAGAATGTATAAGG - Intergenic
1013837845 6:114353806-114353828 ATGAGGAAGCAGAATGTAGAGGG + Intergenic
1014231762 6:118911447-118911469 ACTAAGATGCAAAGTGAAGGTGG + Intronic
1014368382 6:120574115-120574137 ACCATGAAGCAGAATAAAAATGG - Intergenic
1014992282 6:128095628-128095650 ACTAAGCAGAGGAATTAAGAAGG + Intronic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1015334103 6:132016123-132016145 ACAAATAAAAAGAATGAAGAGGG - Intergenic
1015492360 6:133839967-133839989 ACACAGAAGTAGAAGGAAGAAGG - Intergenic
1016340866 6:143060632-143060654 ACGCAGGAGCAGAATGACGAAGG + Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017502679 6:155039775-155039797 AATAAGAGGCAGAATAAAGCAGG + Intronic
1017605618 6:156129327-156129349 ACTAAGCAGCAGACTGCAGCAGG - Intergenic
1018097735 6:160406702-160406724 ACAGAGAGGCAGAAAGAAGAAGG - Intronic
1018107718 6:160504803-160504825 ACCAAGGAGCATAATGAAGTTGG - Intergenic
1018238897 6:161753483-161753505 TCTTAGAAGCAGTACGAAGAAGG + Intronic
1018965303 6:168481308-168481330 ACATAGTAGCAGAATGAACAGGG + Intronic
1019484066 7:1280423-1280445 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1019797661 7:3063691-3063713 AGAAAGAAGAAGAAAGAAGAAGG - Intergenic
1019926149 7:4193854-4193876 ACCAAGAAACATAATGAAGCTGG - Intronic
1020567747 7:9818747-9818769 ACTAAGGAACATAATGAAGTTGG - Intergenic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020657020 7:10940290-10940312 ACTATGAAGTGGAATGATGATGG - Intergenic
1020751643 7:12148199-12148221 ACTAAGAAGTATAATGATGTTGG - Intergenic
1021057061 7:16061997-16062019 ACTCAGAAGGAGAAAGAAAATGG + Intergenic
1021102727 7:16602342-16602364 ACTAAAAAGCAGAGTGAACTCGG + Intronic
1021239926 7:18187850-18187872 AGGAAGAAGCACACTGAAGAAGG - Intronic
1021416804 7:20395817-20395839 ACTAATAAGCAGAAGAAAGTGGG + Intronic
1021457363 7:20844247-20844269 ACTAAGAGGCAGAATGTGGTTGG + Intergenic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022420223 7:30213330-30213352 AGTAAGAAACAGAAAGAGGAAGG - Intergenic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1024009196 7:45253282-45253304 ACTAAGAAAAAGAGTGCAGATGG - Intergenic
1024385196 7:48743081-48743103 ACTAAAATGCAGAAATAAGAGGG + Intergenic
1024999546 7:55303652-55303674 AAAAAGAAGAAGAAAGAAGAAGG + Intergenic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1027742017 7:82020334-82020356 ACTAAGTGGCAGAGTCAAGATGG - Intronic
1028649386 7:93134171-93134193 ACTACAAACAAGAATGAAGATGG - Exonic
1028656677 7:93216661-93216683 AGTCAGTAGCAAAATGAAGAGGG + Intronic
1028675889 7:93460090-93460112 ACTTGGCAACAGAATGAAGAGGG + Intronic
1028753525 7:94409478-94409500 GGGAAGAAGAAGAATGAAGATGG + Intronic
1030141179 7:106305450-106305472 AATAAGAAGCAGAATGCTAATGG + Intergenic
1030518707 7:110569570-110569592 ACTGACAAGCAGAAAGAAGGAGG - Intergenic
1030790725 7:113724843-113724865 ACTAATAAGCAAAATGTACAAGG + Intergenic
1031449050 7:121891261-121891283 ACTAAGGAGAAAAATAAAGAGGG - Intronic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031915697 7:127560853-127560875 CATAAGAAGCAGGAAGAAGAAGG + Intergenic
1032474235 7:132201552-132201574 ATTATGAAGCAGCAGGAAGAGGG - Intronic
1032870300 7:135977527-135977549 ACTGGGAGGCAGAATGAAGGAGG + Intergenic
1032975890 7:137221798-137221820 ACATGGAAGCAGAATGTAGATGG + Intergenic
1033075816 7:138249704-138249726 ACCAAGAAACATAATGAAGTTGG + Intergenic
1033536812 7:142320363-142320385 CCGAAGAGGGAGAATGAAGATGG + Intergenic
1033733048 7:144196620-144196642 CCTAAGTAGGAGAAGGAAGAGGG - Intergenic
1033743900 7:144295200-144295222 CCTAAGTAGGAGAAGGAAGAGGG - Intergenic
1033750001 7:144354367-144354389 CCTAAGTAGGAGAAGGAAGAGGG + Intergenic
1034831027 7:154307494-154307516 ACCATGAAGTATAATGAAGAGGG + Intronic
1035082904 7:156232637-156232659 ACTAAGAGGGAAAATGAAAAAGG - Intergenic
1035102260 7:156410498-156410520 ACTTAACAGAAGAATGAAGATGG - Intergenic
1035119326 7:156552043-156552065 ATTAAGATGCAAAATGAACAGGG + Intergenic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035707218 8:1685698-1685720 ACTAAGAACCAGAATATACAAGG + Intronic
1035766260 8:2108132-2108154 AATTAGAATCAGAAAGAAGATGG - Intronic
1037002514 8:13737118-13737140 GCTAAGAAAAAGAATGAAGTCGG - Intergenic
1037277727 8:17199745-17199767 AAAAAGAAGAAGAAAGAAGAAGG - Intronic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1037492972 8:19412913-19412935 ACTAAGAAGCCACAAGAAGAGGG - Intronic
1037866688 8:22449705-22449727 ACTAAGAAGTAGAGAGAAGATGG + Intronic
1038330012 8:26600888-26600910 ATCAGGAAGCAGAAAGAAGAAGG - Intronic
1038419427 8:27422881-27422903 AATACGAGGCAGAATGAGGATGG + Intronic
1038945041 8:32349836-32349858 ACAGAGAATCAGAAAGAAGATGG - Intronic
1039611267 8:38921219-38921241 ACAAAGGAGGAGAATGGAGAGGG - Intronic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1041568276 8:59305563-59305585 ACTATTCAGAAGAATGAAGATGG + Intergenic
1041985804 8:63921481-63921503 ACCAAGAAACACAATGAAGCTGG + Intergenic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042766449 8:72327223-72327245 ACTCAGGAGAAGAATGGAGAAGG - Intergenic
1043265616 8:78264802-78264824 AGTAAGAAGAAAAATGAAGTTGG + Intergenic
1043765579 8:84127614-84127636 ATTAAGAAGAATAATGTAGAAGG - Intergenic
1043783247 8:84363323-84363345 ACTCAGAAACAGAAGGGAGATGG + Intronic
1044245685 8:89942184-89942206 ACTAAGTGCCAGAATGAAGATGG - Intronic
1044323993 8:90839598-90839620 ACTAAGAAGAGGTATGAATAAGG + Intronic
1044389443 8:91632252-91632274 ACTAAAATGTAGAATGCAGAAGG - Intergenic
1044658705 8:94574527-94574549 ACTAAGCAGTAGAATTAAAATGG - Intergenic
1044723681 8:95174722-95174744 GCTATCATGCAGAATGAAGAGGG - Intergenic
1044985521 8:97753283-97753305 AAAAAGAAGAAGAAGGAAGAAGG + Intergenic
1045186265 8:99841657-99841679 ACTGAGAAGCAGTAGGCAGAAGG - Intronic
1045506522 8:102782495-102782517 ACTCAGAAGCAGAATAAATAAGG + Intergenic
1045660347 8:104430878-104430900 AGTAAGAATCCGAATGGAGATGG - Intronic
1045731950 8:105252473-105252495 ACTAATAACCAGAATGTATAAGG - Intronic
1045977344 8:108144785-108144807 TCTATGAAGTAGAATGAAGTGGG + Intergenic
1046167620 8:110458189-110458211 AAGAAAAAGCAGCATGAAGAAGG + Intergenic
1046644595 8:116771813-116771835 TCTGAGAAGCAGAATGCAGAAGG + Exonic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1049004570 8:139846516-139846538 AATAAGAAGAAAAATGAAGATGG + Intronic
1049292523 8:141812216-141812238 GCTAAGATGAAGAATGGAGAAGG - Intergenic
1049860981 8:144898700-144898722 ATTAATAACCAGAATGCAGAAGG + Intronic
1049904653 9:204719-204741 ACTATGCAGCAGCATGATGATGG - Intergenic
1050836264 9:10083080-10083102 ATAAAGAAGCAGAGAGAAGAAGG - Intronic
1051427752 9:16950828-16950850 AGTAAGAAGCAGAAACAAGCTGG - Intergenic
1051769317 9:20558987-20559009 ACTAAAAGGCTGAATGATGAGGG + Intronic
1051975712 9:22945945-22945967 ACAAGGGAGCAGAATGAAGAAGG - Intergenic
1052066284 9:24024970-24024992 AGAAAGAAGCATAATTAAGACGG + Intergenic
1052648332 9:31267913-31267935 GCCAAGTAGCAGAAAGAAGAAGG + Intergenic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1055624982 9:78167374-78167396 TCTAAGAAGTAGAACTAAGAAGG - Intergenic
1056037878 9:82628125-82628147 ACTACGAGGCAGAATGAAATGGG + Intergenic
1056039151 9:82643107-82643129 ACTAATATCCAGAATGTAGAAGG + Intergenic
1056234687 9:84582916-84582938 ACAAAGAGACAGAATGATGATGG + Intergenic
1056314677 9:85376255-85376277 ACCAAGAAACATAATGAAGCTGG - Intergenic
1056684497 9:88748390-88748412 TCTTAGAAGCAGAAAGTAGAAGG - Intergenic
1056819613 9:89829476-89829498 ATTAAGAAGCAGAGAGAACAGGG + Intergenic
1056937949 9:90932152-90932174 ATTCAGGAACAGAATGAAGAGGG + Intergenic
1057847506 9:98536893-98536915 ACTGAGGAGCAGGATGGAGAAGG - Intronic
1057961552 9:99462272-99462294 ACAGAGAAGCAGATAGAAGAGGG - Intergenic
1058478018 9:105360565-105360587 TCAAAGAACCAGACTGAAGAGGG - Intronic
1058510103 9:105708802-105708824 TCTAAGAAGAAAAATAAAGAAGG - Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058771865 9:108241849-108241871 AATAAGAACCAGAAAGAAAATGG + Intergenic
1058776501 9:108289415-108289437 CCTAAGAAGCAGGAAAAAGAGGG - Intergenic
1059664716 9:116435665-116435687 GTTTAGAAACAGAATGAAGAAGG - Intronic
1061525640 9:131159264-131159286 ATTAAGAACCATAATGAACAAGG - Intronic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1062638466 9:137503991-137504013 AGCAAGAAGAAGAAAGAAGAAGG + Intronic
1062638472 9:137504051-137504073 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1062652447 9:137585039-137585061 ACTCACAAGCAGTATGAGGAAGG + Intronic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1185814986 X:3146313-3146335 AAAAAGAAGAAGAAGGAAGAGGG - Intergenic
1187070253 X:15880706-15880728 AGCAAGAAGCAGAACGAAGTTGG + Intergenic
1187143066 X:16613133-16613155 GCTAAGACGGAGAAAGAAGAGGG + Intronic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1187476033 X:19611754-19611776 CTTAAGAAGCAGAATATAGATGG - Intronic
1187481522 X:19660302-19660324 ATAAAGAAGCATTATGAAGATGG - Intronic
1188205278 X:27348235-27348257 ACCAATACGCAGAATGTAGACGG + Intergenic
1188312896 X:28639665-28639687 TCAAAGAAGCAGAATAAAAAAGG + Intronic
1188727448 X:33603535-33603557 ACTAAGAAGTAAACTGAGGAGGG - Intergenic
1189367202 X:40397937-40397959 AATCAGAAGCAGACAGAAGAGGG - Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1191769863 X:64743118-64743140 ACCAAGAAACATAATGAAGCTGG - Intergenic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1192475737 X:71440911-71440933 AGAAAGAAGGAGAAAGAAGAAGG - Intronic
1192957071 X:76083210-76083232 ACTAATAAGCAGAATATATAAGG - Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193433274 X:81438427-81438449 ACCAAGGAGCATAATGAAGCTGG - Intergenic
1193693449 X:84677694-84677716 ACTAATAACCAAAATGAACAGGG - Intergenic
1194032381 X:88832846-88832868 ACCAAGGAACATAATGAAGATGG - Intergenic
1194703687 X:97148132-97148154 ACTGAGATGCAGAATGATAAAGG + Intronic
1195413263 X:104592340-104592362 ACTGATAAGCACAATGTAGAAGG - Intronic
1195527437 X:105908148-105908170 CCTAAGAAGCAGAGGGAACAAGG + Intronic
1196010117 X:110877852-110877874 AGTAAGCAGCAGAATCAAGATGG - Intergenic
1196357174 X:114808845-114808867 ATTAATAAGCAGAATGTATAAGG - Intronic
1197529483 X:127605560-127605582 ACTAAGGAACATAATGAAGCTGG + Intergenic
1197590310 X:128401677-128401699 ACTAAGATGCAGAGTGAATGTGG - Intergenic
1197743772 X:129916406-129916428 ACTGAGTTGCAGAATGAAGGGGG - Intronic
1198428190 X:136540563-136540585 GCTAAGAAGAAAAATGAAGCAGG - Intronic
1198445147 X:136705990-136706012 ACTAAGATGCAGAATGGACATGG - Intronic
1199024005 X:142916714-142916736 ACCAAGAAACATAATGAAGCTGG + Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199194077 X:145006431-145006453 AGAGACAAGCAGAATGAAGACGG + Intergenic
1199751538 X:150824078-150824100 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199751568 X:150824223-150824245 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199783170 X:151081949-151081971 ACACAGAAGGAGAATGGAGAAGG + Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic
1202201089 Y:22349548-22349570 ACCAAGAAAGAGAAAGAAGACGG - Intronic