ID: 998782662

View in Genome Browser
Species Human (GRCh38)
Location 5:145675623-145675645
Sequence CCACTAAACCAGTTCTCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998782662_998782664 -1 Left 998782662 5:145675623-145675645 CCAATAGAGAACTGGTTTAGTGG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 998782664 5:145675645-145675667 GTCTGCAAACCACAGTGCACAGG 0: 1
1: 1
2: 1
3: 24
4: 194
998782662_998782666 12 Left 998782662 5:145675623-145675645 CCAATAGAGAACTGGTTTAGTGG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 998782666 5:145675658-145675680 AGTGCACAGGCCAAATCTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998782662 Original CRISPR CCACTAAACCAGTTCTCTAT TGG (reversed) Intronic
907522114 1:55030697-55030719 CCACTAAGCCACTCCTCTCTGGG + Intergenic
910806909 1:91197560-91197582 GCACACAACCAGTTCTCTAGTGG - Intergenic
912788582 1:112628358-112628380 ATACTAAACCAGGTCTCTCTCGG + Intronic
916239643 1:162626046-162626068 CCACTAAAACATCTCTCTTTAGG - Intergenic
917381382 1:174412637-174412659 CCACTAAACCAGTTTTACAAGGG - Intronic
918949439 1:191117021-191117043 CTACTAAACTAATTCTTTATTGG - Intergenic
923435613 1:233965149-233965171 CAACTAAAGCAATTCTCTAAGGG + Intronic
923820471 1:237434627-237434649 CCACTGAAACATTTCTCTGTAGG + Intronic
1063198160 10:3762318-3762340 CCACTCACCTTGTTCTCTATGGG - Intergenic
1064079223 10:12294815-12294837 CTGGTCAACCAGTTCTCTATGGG + Intergenic
1064956920 10:20921548-20921570 CCACAATTCCAGTTCTCCATGGG + Intronic
1069887852 10:71635126-71635148 CCACTGACCCAGTGCACTATGGG - Intronic
1087070406 11:94074137-94074159 CCACAAAACCTGTTCTCAACTGG - Intronic
1088495994 11:110431470-110431492 CCACTAATCCCGTTATCTAGTGG + Intronic
1090261506 11:125324218-125324240 CCCCTTAACCAGTTTTCTTTGGG + Intronic
1096003339 12:48148015-48148037 TCACTAAAGCAGATCTCTTTTGG + Exonic
1096625505 12:52893107-52893129 TTACTTAACCAGTCCTCTATTGG - Intergenic
1107728936 13:43328682-43328704 CCCCTAAACCTGTGCACTATTGG - Intronic
1108400796 13:50040248-50040270 GCACTAAACCTCTTCTCTAGAGG + Intergenic
1111506984 13:89203889-89203911 TAAGTAAACAAGTTCTCTATGGG + Intergenic
1115614547 14:35081975-35081997 CCTCCAAACCACTTTTCTATAGG - Exonic
1125011384 15:34879765-34879787 ACACTAAACCTGTTGTCTATTGG - Intronic
1131728689 15:95255758-95255780 CCAATAAAGCAGTTATCTCTTGG + Intergenic
1134429178 16:14185477-14185499 CAACTAAATAAGTTCTCTAAAGG - Intronic
1142788415 17:2243836-2243858 CCACTAGACCAGTTTTCTACTGG - Intronic
1143038503 17:4015351-4015373 CCAATAACCCAGTTCTAAATCGG + Intronic
1150549297 17:66194278-66194300 CCATTGAACCAGATCTCTTTAGG - Intergenic
1153007456 18:510309-510331 CCCATAAATCAGTTCTCTTTAGG - Intergenic
1163222795 19:15934224-15934246 CCCCAAAACCAGTTCTGTTTCGG + Exonic
925210520 2:2041914-2041936 CCACAAAACTATTTCTTTATGGG - Intronic
925244100 2:2364264-2364286 CCCCTAAACCATTTCTATGTTGG - Intergenic
927495093 2:23546682-23546704 CCCCTCAACCAGTACTCTGTGGG + Intronic
935382136 2:102463720-102463742 ACACTGAAACAGTTCTCTTTTGG + Intergenic
935541755 2:104356629-104356651 ACAATGAACCAGTTCTCAATTGG + Intergenic
935582287 2:104766986-104767008 CCAGTTAACCAGTTCTCAGTTGG + Intergenic
947138583 2:226999932-226999954 GCACTAAACAAGTTATCTAAGGG - Intergenic
948444603 2:238022691-238022713 CAAATAACCCAGTTCTCTGTTGG + Intronic
1182036451 22:27202450-27202472 CAACTAATCCAGTGCTCTGTGGG + Intergenic
1182133039 22:27872623-27872645 CCACTCAATGAGTTCTCTGTGGG + Intronic
955587509 3:60497032-60497054 CCTCTAAAGCAGTTCTCAAAAGG + Intronic
956083680 3:65587198-65587220 CCAGTAAACCAGTGGTTTATTGG - Intronic
960773557 3:121222913-121222935 CAACAAAACCTGTTCTTTATAGG + Intronic
961403954 3:126666047-126666069 CCACAAAACCAGGCCTCTCTTGG + Intergenic
962890266 3:139665660-139665682 TCACTAAATTAGTTTTCTATGGG - Intronic
965815347 3:172630497-172630519 CCACTGAACCACCTCTCTAAAGG + Intronic
966962276 3:184952313-184952335 CCAATCAAGCAGTTCTCTAGTGG + Intronic
968343102 3:197975547-197975569 ACACAAAGCCAGTTCACTATGGG + Intronic
971232277 4:24809387-24809409 TCCCTAAACCCCTTCTCTATAGG + Intronic
975619465 4:76281352-76281374 CCTCCAAACCAGTTCTATAATGG - Intronic
975895755 4:79088277-79088299 CCACTAAACAATTTCTGAATGGG + Intergenic
977260318 4:94789166-94789188 ACACTGAACCATTTCTCAATCGG - Intronic
986619403 5:9656093-9656115 CCACAAAATCAGTTCTGTAAGGG + Intronic
986811673 5:11366257-11366279 CCAGTAAAACATTTTTCTATTGG - Intronic
988156944 5:27465615-27465637 ACAATGAACCATTTCTCTATTGG - Intergenic
991196497 5:63940603-63940625 ACAACAAACCATTTCTCTATTGG + Intergenic
991713130 5:69427822-69427844 CCACTGCACCTGTTCTCTATTGG - Intronic
995249289 5:109971776-109971798 CCACTAAACCGGGTCTTTATAGG - Intergenic
996977922 5:129457465-129457487 ACACAAAAGCAGTGCTCTATTGG + Intergenic
998782662 5:145675623-145675645 CCACTAAACCAGTTCTCTATTGG - Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1008818668 6:55603999-55604021 CCAACAAACTACTTCTCTATGGG - Intergenic
1010540728 6:77088841-77088863 CCACTTAAACTGTTCTCTTTTGG - Intergenic
1012743016 6:103044375-103044397 CCAATAAACCAGTTGTGTTTAGG + Intergenic
1016173548 6:141050175-141050197 CCACAAAACCATTTCTTAATTGG + Intergenic
1017929088 6:158937067-158937089 TCACTAAACCATTTCTGTCTGGG + Intergenic
1020698566 7:11447874-11447896 CCACTAAAACACTTCTATAAAGG - Intronic
1034368458 7:150572157-150572179 CCACTAACACAATTCTCAATTGG - Exonic
1034737555 7:153443100-153443122 CCTCCAACCCAGTTCTCTCTCGG - Intergenic
1037171211 8:15894579-15894601 CCAGTAAGCCAGGTCTTTATCGG - Intergenic
1042022851 8:64388535-64388557 CCAAAATACCAGTTCTTTATGGG - Intergenic
1043672837 8:82909824-82909846 CACCTAAAACTGTTCTCTATAGG - Intergenic
1044040762 8:87365805-87365827 TCAATAAACCAGTTATTTATTGG - Intronic
1046629845 8:116612543-116612565 CCACTCACTCAGTTCTCTGTGGG - Intergenic
1047339315 8:123965232-123965254 TAACTTAATCAGTTCTCTATTGG + Intronic
1059713945 9:116895800-116895822 CCACTGCCCCAGTGCTCTATTGG - Intronic
1194334949 X:92634062-92634084 ACAACAAACCATTTCTCTATTGG - Intergenic
1200643426 Y:5751113-5751135 ACAACAAACCATTTCTCTATTGG - Intergenic
1200925568 Y:8651364-8651386 CCACTAATCCAGTTCCTGATAGG + Intergenic