ID: 998782945

View in Genome Browser
Species Human (GRCh38)
Location 5:145678518-145678540
Sequence CATATTTAGCATTATGATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 385}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998782945 Original CRISPR CATATTTAGCATTATGATTT AGG (reversed) Intronic
902092501 1:13914674-13914696 CATATTTAGCATAATTCTTAAGG - Intergenic
905899179 1:41569507-41569529 CAGATTTAGAATTATGTCTTTGG - Intronic
907195962 1:52687279-52687301 CATTTTCATCATTATTATTTTGG - Exonic
907673796 1:56500292-56500314 CATATTAAGGATTATGATGGAGG + Intronic
910020870 1:82587835-82587857 TATCATTAGAATTATGATTTAGG - Intergenic
910039774 1:82835674-82835696 CATATATAGCAGCATGTTTTAGG - Intergenic
911358736 1:96851197-96851219 CATATTCAGCAATATGTATTGGG + Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
911592096 1:99760047-99760069 CAGATTTAACATTCTGAATTAGG - Intronic
911941555 1:104053739-104053761 AATATCTAGTATTATGATTTTGG - Intergenic
912406682 1:109444678-109444700 CATTTTTGGCAAAATGATTTGGG - Intergenic
913082936 1:115406414-115406436 CATATTTAGCATAATTCTTAAGG + Intergenic
913494852 1:119419009-119419031 CATGTATAGAATTATGATTTTGG - Intronic
917294436 1:173504194-173504216 CATATGCAGCACTGTGATTTAGG - Intronic
917388034 1:174499141-174499163 CATATAATGCATTATGATATGGG + Intronic
918435903 1:184512678-184512700 CATTTCTAGCTTTATAATTTTGG + Intronic
918476404 1:184929428-184929450 CATTTAAAACATTATGATTTTGG - Intronic
919474471 1:198017447-198017469 CATATTTAGGAAGATGATTTGGG + Intergenic
920215036 1:204356669-204356691 CATATATATCATTAAAATTTTGG - Intronic
920759716 1:208771159-208771181 CATTTTTAGAATTATGAGTAAGG - Intergenic
921479204 1:215644489-215644511 AATGTTTAGGATTAAGATTTGGG + Intronic
921498902 1:215876200-215876222 TATAATGAGCATTATAATTTAGG + Intronic
921501231 1:215905833-215905855 CATTTTTGGCATTCTCATTTAGG + Intronic
922024325 1:221736723-221736745 TATAATTATCATTATCATTTTGG - Intronic
923993727 1:239468461-239468483 AATGTTTGGCATTATGTTTTTGG + Intronic
924333632 1:242965431-242965453 CTTACTTAGCATAATGATTAGGG - Intergenic
924375703 1:243406235-243406257 CATATTTGGCCTTATTATTTAGG + Intronic
1063512988 10:6664536-6664558 CAAATTAAGCAATATAATTTGGG - Intergenic
1063656172 10:7991752-7991774 CATATAAAGCATGGTGATTTTGG + Intronic
1065910580 10:30300492-30300514 CATATTTAGTATCTTGATTTTGG + Intergenic
1067992716 10:51233462-51233484 AATAGTTAGCATTCTGATATGGG + Intronic
1068008035 10:51413114-51413136 CATATTTGTCATTTTGAATTAGG - Intronic
1068663762 10:59650363-59650385 AAAATTTTGCATTTTGATTTTGG + Intergenic
1069102576 10:64341505-64341527 CATGTTTAGCATTATGCTGGGGG + Intergenic
1069180799 10:65355828-65355850 AATATATACCATTATGTTTTAGG + Intergenic
1069816187 10:71196102-71196124 CATATCAAGCAGTATTATTTTGG + Intergenic
1070601541 10:77869538-77869560 CATCTCTAGCAATATGATTCTGG + Intronic
1071076178 10:81755906-81755928 CCAATTTAGCATCTTGATTTGGG - Intergenic
1071954657 10:90744543-90744565 CACATTTAGCATTAAGGATTAGG + Intronic
1073157121 10:101355887-101355909 CATATTTAGAATTTTAATGTTGG - Intronic
1074227661 10:111502678-111502700 CATTTTTAGCAGTTTGATTTTGG + Intergenic
1074265562 10:111899637-111899659 CACATTTAGCAGTGTGACTTTGG + Intergenic
1074409653 10:113215745-113215767 GATATTTTCCATTATGCTTTTGG + Intergenic
1074587030 10:114777905-114777927 AATCTTTTGCACTATGATTTTGG + Intergenic
1075785290 10:125045385-125045407 CAAATTTAGTTTTATGTTTTTGG + Intronic
1076087771 10:127650232-127650254 CATATTTAGAATTGTTACTTTGG - Intergenic
1076490342 10:130857168-130857190 ATTATTTAGAATTAAGATTTGGG + Intergenic
1078731093 11:13974723-13974745 CATATTCAGATTTATGGTTTAGG - Intronic
1078883438 11:15476331-15476353 CATTGTTACCATTATGACTTGGG - Intergenic
1079507810 11:21173906-21173928 CATAATTATTATTATCATTTAGG - Intronic
1079685164 11:23350556-23350578 AATATTTTGCATTAGGAATTAGG - Intergenic
1080887417 11:36379137-36379159 CAAAGTGAGGATTATGATTTAGG - Intronic
1084992030 11:72935072-72935094 AGTATTTAACATTATGAGTTTGG - Intronic
1085944035 11:81244640-81244662 CATAATTAGACTTTTGATTTTGG - Intergenic
1086911332 11:92475760-92475782 CATATTTATGAGTATGAATTTGG + Intronic
1087372121 11:97298237-97298259 CATATTTAGAAATGTGATGTCGG + Intergenic
1087538622 11:99485474-99485496 CATATGTACCATTGTGTTTTGGG + Intronic
1088221647 11:107576348-107576370 CATACCTATCATTATTATTTGGG + Intergenic
1088516113 11:110636027-110636049 CATCTTTTGCATTTTGGTTTAGG + Intronic
1088743956 11:112788983-112789005 CTTTTTTAGAATTATAATTTTGG + Intergenic
1090851316 11:130572962-130572984 CGTATTTATCTTGATGATTTTGG + Intergenic
1091041737 11:132287250-132287272 CATAGTCAGAATTATGATTTTGG + Intronic
1093069473 12:14693571-14693593 CATGTTGAGCATCATTATTTGGG - Intronic
1093422963 12:18996072-18996094 CCAGTTTTGCATTATGATTTTGG - Intergenic
1093842423 12:23920493-23920515 CTTATTTCCCATTTTGATTTAGG + Intronic
1094185782 12:27641197-27641219 GATACTTACCATTCTGATTTAGG + Intronic
1094198072 12:27770031-27770053 AATATTTGGAAATATGATTTTGG + Intronic
1094364880 12:29669644-29669666 TTTACTTAGCAGTATGATTTAGG + Intronic
1094440105 12:30465750-30465772 CATATTTAGCATAATTCTTAAGG + Intergenic
1095361600 12:41347924-41347946 CAAATTTCGCATCATGTTTTAGG - Intronic
1095448667 12:42306600-42306622 CATATTTAGCACTATGTTTCAGG - Intronic
1095546735 12:43380320-43380342 CATAGTTAGCATACTGAATTAGG + Intronic
1095904323 12:47361742-47361764 CATATTTAGAATTGTGTTTGAGG + Intergenic
1099261983 12:80394824-80394846 CATATTCAGCAGCTTGATTTTGG + Intergenic
1099818520 12:87679329-87679351 CATATTTCCCATTTTGCTTTTGG + Intergenic
1099858013 12:88193630-88193652 CCTATTTAGCCATATGACTTTGG - Intronic
1100102748 12:91129126-91129148 TTTATTTAGTATTATAATTTTGG + Intergenic
1100324456 12:93528027-93528049 CATACTTGGCATTTTGAATTGGG - Intergenic
1100808222 12:98310675-98310697 CATTTTTGGAATTATGTTTTAGG - Intergenic
1101976642 12:109365435-109365457 TCTATTTAGCATTATGGCTTCGG + Intronic
1103266528 12:119635351-119635373 AATATTTAGAATTATTTTTTGGG - Intronic
1105351317 13:19618788-19618810 CATCTTTAGGATGATTATTTTGG + Intergenic
1105662546 13:22514349-22514371 TATATTCAAAATTATGATTTAGG - Intergenic
1107052636 13:36067836-36067858 CTCATTTAGCATAGTGATTTTGG - Intronic
1107429262 13:40325025-40325047 CATCTCTAGAATTTTGATTTAGG + Intergenic
1107806467 13:44158159-44158181 CATGTGTAGCATTCTGTTTTGGG + Intronic
1107816650 13:44250451-44250473 CATATTCAGCAGTAGGATTCAGG + Intergenic
1108073888 13:46658989-46659011 CAAATTTAACATTTTAATTTGGG + Intronic
1108434556 13:50389039-50389061 TTTATTTAACATTATGATGTAGG + Intronic
1108754966 13:53488901-53488923 CATATTTATCATTTTCATGTGGG - Intergenic
1108765395 13:53622296-53622318 CACATTTAGTATTTTGATTCTGG - Intergenic
1108857847 13:54818382-54818404 CACATTTATCATTGTAATTTAGG + Intergenic
1108875449 13:55043275-55043297 CATATTTAAATTTATGATTTTGG - Intergenic
1109121989 13:58469308-58469330 CATATTTCGAATTGAGATTTGGG + Intergenic
1109349031 13:61153022-61153044 CACTTATAGCATTATCATTTTGG - Intergenic
1110817264 13:79875909-79875931 CACATTGAGGATTAGGATTTTGG + Intergenic
1111476551 13:88756918-88756940 CTTACTTAGCATACTGATTTAGG + Intergenic
1111504478 13:89168972-89168994 CATTTTTATCATTACCATTTTGG + Intergenic
1112779648 13:102885068-102885090 CAAATCTATCATTATGGTTTGGG - Intergenic
1113012009 13:105778913-105778935 AATATTTAGTAATATGATTAGGG - Intergenic
1113014415 13:105811732-105811754 AGTATTTAGGATTATGATTTTGG + Intergenic
1113942424 13:114025203-114025225 CAGTTTTAGCAACATGATTTTGG - Intronic
1114033889 14:18602507-18602529 CATATTTGGGTTTATTATTTTGG + Intergenic
1114078684 14:19181681-19181703 CATATTTGGGTTTATTATTTTGG + Intergenic
1114124755 14:19712504-19712526 CATATTTGGGTTTATTATTTTGG - Intergenic
1114311341 14:21470309-21470331 CTTAATAAGCTTTATGATTTGGG - Intronic
1114678715 14:24464355-24464377 CATATTTAGCATCCTTTTTTGGG + Intergenic
1115116542 14:29887068-29887090 CTTATTTTGCATTATACTTTTGG - Intronic
1115571954 14:34675069-34675091 CATAGTTTACATTAGGATTTAGG - Intergenic
1115795252 14:36928006-36928028 CGTATTTAACATTATAACTTCGG - Intronic
1116118168 14:40684249-40684271 CATTTGTGGCATTATGGTTTAGG - Intergenic
1116186035 14:41601735-41601757 GATATGTAGCATTTTCATTTAGG - Intergenic
1116412104 14:44637130-44637152 TATATTTAGCAAAAAGATTTAGG - Intergenic
1116530206 14:45962537-45962559 CATCTTTAGAAGTTTGATTTGGG + Intergenic
1118415499 14:65531410-65531432 GTTAATTAGCATTGTGATTTAGG + Intronic
1118901081 14:69986503-69986525 TATAGTTAGCATAATGATATGGG - Intronic
1119800582 14:77441548-77441570 CATAATTAACATTACCATTTTGG + Intronic
1120139244 14:80909672-80909694 CATTTTTAGTTTTATGTTTTAGG - Intronic
1120586572 14:86318778-86318800 CATTTTTATTATTATTATTTAGG - Intergenic
1121971655 14:98363100-98363122 CATGTTTAATATTATGTTTTTGG - Intergenic
1202895826 14_GL000194v1_random:9396-9418 CATATTTATCATAAGAATTTTGG - Intergenic
1123842730 15:24265441-24265463 CTTATATATGATTATGATTTTGG - Intergenic
1123857770 15:24431467-24431489 CTTATATATGATTATGATTTTGG - Intergenic
1123862402 15:24482025-24482047 CTTATATATGATTATGATTTTGG - Intergenic
1125124591 15:36205344-36205366 CAAATTGAGCATTGTGACTTTGG - Intergenic
1125918890 15:43512698-43512720 CTTGTTTAGCATTTTTATTTAGG + Intronic
1126330354 15:47524703-47524725 CATGTTTAGCATTATCCTTGGGG + Intronic
1128722646 15:69962401-69962423 CAGATTTAGCATAATTATTAAGG - Intergenic
1128951416 15:71887239-71887261 TATACTTAGCAGTATGATTTGGG - Intronic
1131505446 15:93014272-93014294 GATATTTAGCTTGATGACTTGGG + Intronic
1131692485 15:94842305-94842327 CAGATTTAGCATTTTAGTTTGGG + Intergenic
1131914471 15:97249619-97249641 CTTATTTAGAGTTATCATTTTGG - Intergenic
1132123387 15:99197513-99197535 CATATTTAGCACTATGTATCAGG + Intronic
1135300424 16:21322009-21322031 CATATTTTGTATTACTATTTGGG - Intergenic
1135507044 16:23047958-23047980 CATTTTAAGTTTTATGATTTAGG - Intergenic
1138935984 16:61723749-61723771 TATATTTGGCTTTCTGATTTTGG + Intronic
1139784666 16:69383057-69383079 CGTATTTATTATTATTATTTAGG - Intronic
1140268712 16:73443585-73443607 CATTTTCAGCCTTATGACTTTGG + Intergenic
1140841868 16:78847178-78847200 CATATTTAGAACTAAGATCTAGG + Intronic
1143396154 17:6599057-6599079 TATATTTAGTATTATGACTTAGG - Intronic
1147480377 17:40755643-40755665 GAAATTTAGCATCATGGTTTTGG + Intergenic
1147540640 17:41355073-41355095 CCTATTTATCATTAAGGTTTGGG + Intergenic
1149071845 17:52552807-52552829 CATGCTTATCATCATGATTTTGG - Intergenic
1149986990 17:61354831-61354853 CATTTTTAGCTTTGTTATTTTGG - Intronic
1150174333 17:63034266-63034288 TATATTTAGCATCATTCTTTAGG - Intronic
1151410384 17:73922531-73922553 CATATTTTGCATTTTGGTTCTGG - Intergenic
1152171381 17:78751410-78751432 GAAATTCAGCATTATGATTAGGG + Intronic
1153038934 18:792335-792357 CATATTTACCATTTTGGATTTGG + Intronic
1153493090 18:5669914-5669936 TATATTTAGCAATAGGATTTAGG + Intergenic
1155697850 18:28704823-28704845 CTAATTTAAAATTATGATTTTGG + Intergenic
1155820125 18:30364472-30364494 CATGGTAAGCATTATAATTTAGG + Intergenic
1155838414 18:30616116-30616138 AATATGTAGCAGTAGGATTTTGG - Intergenic
1156821599 18:41379556-41379578 CTTGATTAGCATTTTGATTTTGG + Intergenic
1156832852 18:41515722-41515744 AATATTTAGAACAATGATTTTGG + Intergenic
1156851182 18:41728335-41728357 AATATTTAGTATTGTTATTTGGG - Intergenic
1157086718 18:44587704-44587726 AATATGTAGAAATATGATTTTGG - Intergenic
1158982853 18:62781674-62781696 CATATTTAACATAATTAATTTGG - Intronic
1159054100 18:63448090-63448112 CACTTTTAGCATCATGATGTGGG + Intergenic
1160131914 18:76232859-76232881 CATATTGAGCATTGTGTGTTTGG - Intergenic
1160548275 18:79676511-79676533 CATGTTTAGGACTATGAATTTGG - Intergenic
1163879940 19:19910408-19910430 CATATATATTATTATGGTTTAGG - Intronic
1163896046 19:20060261-20060283 GATATATATCATTATGGTTTAGG + Intergenic
1163904039 19:20135664-20135686 GATATATATCATTATGGTTTAGG + Intergenic
1163909846 19:20179242-20179264 GATATCTATCATTATGTTTTAGG - Intronic
1164266950 19:23628208-23628230 CATAGTTGACATTATGATGTTGG + Intronic
1164654952 19:29913948-29913970 CAAGTTGAGCATTAGGATTTTGG + Intergenic
925204233 2:1992806-1992828 AAGATTTAAAATTATGATTTAGG + Intronic
925801285 2:7604467-7604489 TAAAATTAGCATTATTATTTTGG + Intergenic
926594866 2:14779225-14779247 CATATTAGGAATTATCATTTTGG + Intergenic
927105972 2:19825891-19825913 TATGTTTTGCATTATTATTTTGG - Intergenic
927294209 2:21434945-21434967 CAGATTTGGTATTTTGATTTGGG - Intergenic
929201385 2:39240714-39240736 CTCACTTAGCATTATGTTTTGGG - Intergenic
930351316 2:50259012-50259034 CACATTTAGCATAATTATTAAGG + Intronic
930790362 2:55320685-55320707 CACATTTAAAATTATGAGTTAGG - Intronic
931111817 2:59119138-59119160 CATTTTTAACATAATGAATTTGG - Intergenic
931631424 2:64304577-64304599 AATATTCAGTATTATGATTTTGG + Intergenic
932209064 2:69912585-69912607 CATTTTTAGTATTATCACTTTGG + Intronic
932936035 2:76102470-76102492 CATATTTTGCATTCCGTTTTGGG + Intergenic
935219979 2:101003811-101003833 CAAATTTAGTATTTTGATTGAGG + Intronic
935332220 2:101985609-101985631 CACAGGTATCATTATGATTTAGG + Intergenic
935926081 2:108070437-108070459 TATATTTGGTATTAAGATTTTGG - Intergenic
936418760 2:112344621-112344643 CATATTTATAATTTTGATTTTGG - Intergenic
936808514 2:116367353-116367375 ATTATTTAGCAATATTATTTGGG - Intergenic
938492372 2:131768549-131768571 CATATTTATCATAAGAATTTTGG + Intergenic
938495197 2:131793801-131793823 CATATTTATCATAAGAATTTTGG - Intergenic
938878022 2:135554294-135554316 TTTATTTAGCATAATGTTTTTGG + Intronic
939202529 2:139056476-139056498 CTGATTGAGCATTATGATTTGGG + Intergenic
939314923 2:140536086-140536108 CATCTTTAGCAATAGGTTTTAGG - Intronic
939516209 2:143171468-143171490 CATCTTTAGCAATATAATTGTGG - Intronic
940600847 2:155857902-155857924 CATATTTACCAGTATTATTGTGG - Intergenic
940847115 2:158653754-158653776 CAAATTTTGCATTAGGATGTTGG + Intronic
940978549 2:159974627-159974649 CATATTGAACATTATGGTTTTGG + Intronic
941585214 2:167350169-167350191 GTTACTTAGCATTATGATTCTGG - Intergenic
942650368 2:178160794-178160816 GATTTTTAGCTTTATGATTTTGG + Intergenic
943204290 2:184872540-184872562 CATTTTTAGGTTTATCATTTAGG - Intronic
943253367 2:185560120-185560142 CATCTGTTGCATTATTATTTAGG - Intergenic
943884719 2:193201638-193201660 CACATTTTTCATTATGTTTTAGG - Intergenic
944797714 2:203205414-203205436 AATGTTAAGCATTCTGATTTTGG - Intronic
945124481 2:206493217-206493239 CATAGTTAGGATTCTTATTTGGG - Intronic
945693322 2:213069813-213069835 CAAAGTTAGCAATATGTTTTTGG + Intronic
945775474 2:214101831-214101853 AACATTTAGCATAATGCTTTAGG + Intronic
946559178 2:220893162-220893184 CATATTTAGCATTAAAGTTAAGG + Intergenic
946992284 2:225347823-225347845 TATATTTATCATTATGTTTAAGG + Intergenic
947167953 2:227281942-227281964 AATATTTAGCTTTGTGATTTGGG - Intronic
947174165 2:227345332-227345354 AATATTTAGAATTATAATCTTGG - Intronic
948718008 2:239878059-239878081 CATCTCTAGAATTTTGATTTTGG - Intergenic
1169040805 20:2493775-2493797 CACCTTTCGCTTTATGATTTTGG + Exonic
1170205366 20:13792237-13792259 CATATTTAGCAACATCATGTTGG + Intronic
1173108919 20:40166536-40166558 CATATTTAGAATTCTGAGTAAGG + Intergenic
1173267825 20:41502194-41502216 CATATGTAGCTTAATGATGTTGG - Intronic
1174960750 20:55154443-55154465 CCTAATTAGCATCATGTTTTAGG + Intergenic
1176615515 21:9025456-9025478 CATATTTATCATAAGAATTTTGG - Intergenic
1176709665 21:10138346-10138368 CATATTTATCATAAGAATTTTGG + Intergenic
1178564784 21:33673316-33673338 AATATTTAGCATGATGACTCTGG + Intronic
1178721185 21:35011025-35011047 TATTTATAGCATTTTGATTTTGG - Intronic
1178966898 21:37128772-37128794 AATAGTGATCATTATGATTTAGG - Intronic
1179357050 21:40670008-40670030 AATAATTATGATTATGATTTTGG + Intronic
1180458007 22:15529549-15529571 CATATTTGGGTTTATTATTTTGG + Intergenic
1181612820 22:24030326-24030348 TCTTTTTAGCATTATGACTTTGG + Intronic
1182466941 22:30522990-30523012 AATATTTAGCCTTTTGATTCTGG - Exonic
1184841602 22:47055474-47055496 CATATTGAGAATTTTGATTAGGG + Intronic
1184994136 22:48192051-48192073 CATTTTTATCATCATGTTTTTGG + Intergenic
950069104 3:10137697-10137719 CATATGTAGCCTTATGAGTTTGG - Intergenic
950314945 3:11993467-11993489 TATATTTAGCATAATTATTAAGG + Intergenic
950761515 3:15233767-15233789 CTGATTTGGCATAATGATTTTGG - Intronic
951155314 3:19345994-19346016 CATATCTAGGGTAATGATTTGGG - Intronic
952567953 3:34680968-34680990 CTTATTTAGCATGATAAATTTGG - Intergenic
953780491 3:45865517-45865539 CATATTTATCATTAAAAGTTTGG - Intronic
953892292 3:46760870-46760892 CATTTTTAGAAGTTTGATTTGGG - Intronic
955716987 3:61840397-61840419 TATATGTTGAATTATGATTTGGG + Intronic
956174854 3:66463261-66463283 CATAAGTAGCCTTATGATTCAGG - Intronic
957027312 3:75196863-75196885 TTTACTTAGCATTATGCTTTTGG - Intergenic
957126899 3:76173115-76173137 CATAACTAGCTTTATGACTTTGG + Intronic
957431575 3:80115778-80115800 TATATTTAGCCTAATGTTTTGGG - Intergenic
957774048 3:84732486-84732508 CATAGTTAGCAATATGAGTCTGG + Intergenic
958089869 3:88862983-88863005 CATATTAAGCACTATGATCAAGG + Intergenic
958177204 3:90011652-90011674 CATCTTTACAATTACGATTTGGG + Intergenic
958872441 3:99577048-99577070 CATACTTACTTTTATGATTTAGG - Intergenic
960016258 3:112891989-112892011 CATCTTTAGAAATTTGATTTGGG - Intergenic
960204517 3:114879060-114879082 TATATTTAACATTATTAATTTGG + Intronic
960884678 3:122382469-122382491 CATATTTAAGATCATGATTTTGG + Intronic
961930840 3:130531143-130531165 CATATTTAGCACATTGAATTAGG - Intergenic
962014765 3:131428468-131428490 TAGATTTAGCATTATGGTTTTGG - Intergenic
962888921 3:139654058-139654080 CATAGTGAGCATGATGGTTTTGG - Intronic
963579482 3:147107469-147107491 TATATTAAAAATTATGATTTAGG - Intergenic
963917824 3:150876010-150876032 CATATTTAGAATCCTGCTTTTGG - Intronic
964129844 3:153274327-153274349 AATATTTCAAATTATGATTTTGG + Intergenic
964236889 3:154541866-154541888 GAAATGTGGCATTATGATTTAGG - Intergenic
964837903 3:160959904-160959926 TGTATTTAGCATTATCATATAGG - Intronic
965504517 3:169497708-169497730 CATAATCAGAATTATGCTTTAGG - Intronic
965797590 3:172457381-172457403 TACATTTAACATTAGGATTTCGG + Intergenic
966007993 3:175040101-175040123 TCTACTTAGCATCATGATTTGGG + Intronic
966009906 3:175062156-175062178 CTAATTTAGCATTACTATTTGGG + Intronic
966173500 3:177110686-177110708 CATATCTAGAATTGTGTTTTAGG - Intronic
966245278 3:177801363-177801385 CATATGTAGGTTTATGGTTTAGG - Intergenic
967236920 3:187393921-187393943 CATATTTAGCATGTAGGTTTTGG + Intergenic
968387893 4:160255-160277 CAAATATAGCATTGTGCTTTAGG - Intronic
969505061 4:7580893-7580915 CATATCTATTATTATAATTTGGG - Intronic
970088279 4:12372544-12372566 CATTTTTAGCAAAATTATTTTGG + Intergenic
971554244 4:27992858-27992880 CATATTAAGTATTAAGATTTAGG + Intergenic
972205233 4:36763721-36763743 CTTATTTAGCCATATGACTTAGG + Intergenic
972862537 4:43188328-43188350 CATAGTGAGGATTATGCTTTTGG + Intergenic
973107617 4:46360134-46360156 CTTATTTAGCATTTTGATTGTGG + Intronic
973109555 4:46379979-46380001 CATACTTATCTTTATGATTATGG - Intronic
973160792 4:47013542-47013564 CATTTTTAGCATTATCAGGTTGG - Intronic
973733565 4:53847472-53847494 CATTTTTAGGCATATGATTTTGG - Intronic
974072634 4:57138822-57138844 CATAATTTACAATATGATTTTGG + Intergenic
974103058 4:57438592-57438614 CATATGTAGCCTTTTGATTGTGG + Intergenic
974217189 4:58864799-58864821 AATATTTAGCAATGTGACTTTGG + Intergenic
974263387 4:59554144-59554166 CATATTTAGTATAAAGATTTGGG + Intergenic
975880840 4:78905669-78905691 CATATTTAGGCTTATACTTTTGG + Intronic
976137557 4:81955125-81955147 CATGTTTAACATGATGAGTTTGG - Intronic
976239392 4:82938143-82938165 AATAGTTAGCATCATCATTTTGG + Intronic
976808626 4:89075840-89075862 CATATCAAACATTATGATTGTGG - Intronic
977057880 4:92216403-92216425 CCTATTTAACATTTTGAGTTTGG + Intergenic
977128170 4:93197315-93197337 CCTGTTTCGCTTTATGATTTGGG + Intronic
977958997 4:103063396-103063418 CATGTTTACCATTATCATCTGGG - Intronic
978530272 4:109705198-109705220 CATATTTAGCATAATTCTTAAGG - Intergenic
978659971 4:111114073-111114095 CATACTTGGCATTATTACTTGGG + Intergenic
980343387 4:131581421-131581443 AAGAAATAGCATTATGATTTGGG - Intergenic
980681093 4:136161381-136161403 CATATTCTGCATTTTCATTTTGG + Intergenic
982605073 4:157505512-157505534 CAAATTATGAATTATGATTTTGG - Intergenic
982994338 4:162322109-162322131 CATTTTTAGCAATGTCATTTAGG + Intergenic
983154077 4:164322904-164322926 CATATTTAGCAATCATATTTAGG - Intronic
983984458 4:174041277-174041299 TATTTTTAGCATTAAGAATTTGG - Intergenic
984125386 4:175802830-175802852 TATTTTTAGCATTGTGATTCTGG - Intronic
984135930 4:175939022-175939044 TATATTTAGCATTATTCTTTTGG - Intronic
985111357 4:186549216-186549238 CATATTTAGGAATATGTTCTTGG - Intronic
986028974 5:3877741-3877763 AATATTTAGCATTGTGTATTAGG - Intergenic
986713477 5:10504462-10504484 CATGTTTGACAGTATGATTTGGG + Intergenic
988132654 5:27124487-27124509 CATATTTTTCATTCTCATTTAGG - Intergenic
988640128 5:33032641-33032663 CATTTTCAGTACTATGATTTGGG - Intergenic
989281594 5:39650211-39650233 CATATTCAACAATATGATTTGGG + Intergenic
990059302 5:51627892-51627914 TATACTTTGCATTATGTTTTTGG - Intergenic
991222385 5:64231570-64231592 AATATTTCGCATAATGATTTGGG - Intronic
993254345 5:85569462-85569484 CTTACTTAGCATAATGTTTTTGG + Intergenic
993515880 5:88834362-88834384 GATATTAAGCATCATGATTTTGG - Intronic
993740680 5:91534810-91534832 CATACTTAGTATTTTCATTTCGG + Intergenic
993982093 5:94554912-94554934 AATTTATAGCATTATGATTCAGG - Intronic
994108215 5:95969982-95970004 CTTATTTAGAATTATGACTATGG + Intergenic
995065093 5:107852636-107852658 CACATTAAGCATAATTATTTAGG + Intergenic
995604909 5:113843323-113843345 CCTCTTTAACATTTTGATTTTGG + Intergenic
995984589 5:118154211-118154233 CATGTTTAGTATTATAATTTAGG - Intergenic
996148294 5:120002500-120002522 CATTTTTAACATTTTGAGTTTGG - Intergenic
996282684 5:121750328-121750350 CATTTTTGGTATTATGTTTTTGG - Intergenic
996314466 5:122146226-122146248 TATATTTAGCTTTATGATATGGG - Intronic
996602757 5:125285286-125285308 CATAATTAGAATTCTGATCTGGG + Intergenic
997348618 5:133212788-133212810 CATTCTTTGTATTATGATTTGGG - Intronic
998782945 5:145678518-145678540 CATATTTAGCATTATGATTTAGG - Intronic
1000046505 5:157526073-157526095 CAACTTAAGCATTATGTTTTAGG - Intronic
1000760444 5:165217025-165217047 CATATTGTGGATTATGAGTTAGG + Intergenic
1000896778 5:166864955-166864977 CATTTCTAGCAGAATGATTTGGG - Intergenic
1001975981 5:175998909-175998931 CATCTTTAGAAGTATGATTTGGG - Intronic
1002241445 5:177844863-177844885 CATCTTTAGAAGTATGATTTGGG + Intergenic
1003210709 6:4063183-4063205 AGTTTTCAGCATTATGATTTGGG + Intronic
1004839210 6:19563247-19563269 CATATTTAGGAAGTTGATTTGGG + Intergenic
1005018598 6:21396642-21396664 CATTGTTAACATTCTGATTTTGG + Intergenic
1005049343 6:21669051-21669073 CTTATTTAGGATGATGATTTGGG + Intergenic
1005141097 6:22632476-22632498 CATATTAAGCATTATTGTTAAGG - Intergenic
1005521683 6:26607032-26607054 CAAAATTAGCATGATAATTTGGG + Intergenic
1007040040 6:38713550-38713572 CATATTTAGTATTATTTCTTAGG + Intergenic
1007545947 6:42694751-42694773 CATATGTAGCATTTTGAGTCTGG + Intergenic
1008092995 6:47310707-47310729 AATTTTTAGCATTATTTTTTGGG - Intergenic
1009245293 6:61230517-61230539 CTGAGTTAGCATTATGAGTTGGG + Intergenic
1009851738 6:69207657-69207679 CATAGTTAGCATTGTAATTGTGG + Intronic
1009869709 6:69438589-69438611 CATAGTTAGCATTTTTATTAGGG - Intergenic
1010007748 6:71013942-71013964 AATATTTAGCATTATCAATAAGG - Intergenic
1010065990 6:71682774-71682796 CATATATTGTATTATGAGTTTGG + Intergenic
1010442471 6:75913181-75913203 CATCTTTAGCAGCATAATTTTGG - Intronic
1010788391 6:80032734-80032756 CATCTCCAGCATTATTATTTTGG + Intronic
1011396281 6:86912261-86912283 CATGTGTAGTATTATTATTTGGG - Intergenic
1011638605 6:89399077-89399099 CATATCTAGCAGTATAAATTGGG - Intronic
1012085643 6:94823216-94823238 GCTGTTTAGAATTATGATTTGGG - Intergenic
1012595992 6:101040832-101040854 TATATTCAGTTTTATGATTTAGG + Intergenic
1012966622 6:105681726-105681748 CATTTCTAGAATTTTGATTTAGG - Intergenic
1013872167 6:114778068-114778090 CATATATAGCATTATGTATCTGG + Intergenic
1014079664 6:117271628-117271650 AATATTTAGAATTATGCTTATGG + Intronic
1014157682 6:118130061-118130083 CATGTTTAGCATTATGTTATGGG + Intronic
1014394058 6:120902308-120902330 TATTTGTAGCATTGTGATTTAGG - Intergenic
1014535919 6:122612573-122612595 CTTACTTAGCATAATGTTTTTGG + Intronic
1014560055 6:122879102-122879124 CATATTTTGCCTTAGGATTAAGG - Intergenic
1014948644 6:127527972-127527994 CAAATTAAGCAATATTATTTAGG + Intronic
1015494701 6:133867846-133867868 GATATATATCATTATGGTTTAGG - Intergenic
1016104982 6:140150251-140150273 TAGATTCAGCATTATGATTTTGG + Intergenic
1016430887 6:143984088-143984110 TATATTTATAATAATGATTTAGG + Intronic
1018090476 6:160342680-160342702 CCTATTTAGCATTTTCTTTTTGG + Intergenic
1018230868 6:161673907-161673929 CATATTTGGCATTATGAAGCAGG + Intronic
1018583891 6:165334679-165334701 CATATTGCCCATTATGACTTAGG + Intronic
1021281567 7:18725730-18725752 CAAATATATAATTATGATTTGGG - Intronic
1022616745 7:31939429-31939451 AATATTTAGTGATATGATTTTGG + Intronic
1023714016 7:43024682-43024704 CATCTTTAGAATCATGAGTTAGG - Intergenic
1025127809 7:56358084-56358106 TATATATAGCAGTATAATTTTGG + Intergenic
1026285371 7:68958060-68958082 TAGATTTTGCCTTATGATTTTGG - Intergenic
1027982049 7:85237240-85237262 CAAATTTATCACTATGGTTTGGG - Intergenic
1028265482 7:88718790-88718812 CATTTTTAATATTATTATTTAGG - Intergenic
1028311721 7:89346430-89346452 CTTAATTAGCATTTTGAATTAGG + Intergenic
1028441197 7:90863101-90863123 AATATATACCATTATAATTTTGG - Intronic
1030587640 7:111440607-111440629 CATATTCAGCATAATGCTTAAGG + Intronic
1032187386 7:129738584-129738606 CACATTGAGCATAATTATTTAGG + Intronic
1033081415 7:138301954-138301976 CATATTTTGAATTCTAATTTTGG + Intergenic
1034000311 7:147404582-147404604 CAGATTTAGCATGATGAAATGGG - Intronic
1034074693 7:148220400-148220422 CATAGTTAACATTATGATGTTGG - Intronic
1035405376 7:158593626-158593648 CAAGATTAGAATTATGATTTAGG - Intergenic
1037349353 8:17933832-17933854 GATATGTAGCATTCTTATTTTGG + Intronic
1039027085 8:33270104-33270126 CATATTTAGCATTTTACTTGTGG - Intergenic
1040948589 8:52912475-52912497 GAGAATTAGCATAATGATTTAGG + Intergenic
1041624757 8:60013137-60013159 CATGTTTACATTTATGATTTAGG - Intergenic
1041840255 8:62261665-62261687 AATATTTAGTATTTTGATGTGGG - Intronic
1042081213 8:65054037-65054059 CTTGTTTAGCATTAAGATTCAGG - Intergenic
1042823443 8:72956641-72956663 TCTATTTAGCATAATGCTTTTGG - Intergenic
1042993852 8:74671273-74671295 CATTTTGTGTATTATGATTTAGG + Intronic
1043606876 8:82011324-82011346 CAAATTTGGTAGTATGATTTTGG + Intergenic
1043755096 8:83993716-83993738 TATATTTAGCACTCTCATTTAGG + Intergenic
1043842578 8:85125902-85125924 AATAATTATCATTATGACTTTGG + Intronic
1043969907 8:86517233-86517255 CACATTTACCAATATGAATTAGG + Intronic
1044367602 8:91367726-91367748 CTTAGTTAGCATTATTAGTTTGG + Intronic
1045390471 8:101709928-101709950 CAAATTTAGGAACATGATTTAGG - Intronic
1046411815 8:113854673-113854695 CATATTTCTAATTATTATTTAGG + Intergenic
1046857022 8:119044044-119044066 CATATTTACCATTAGGCTGTTGG + Intronic
1048754021 8:137714698-137714720 CATATTTAGCATAATCTTTCTGG - Intergenic
1048850885 8:138644358-138644380 CATATTTAGGGTGAGGATTTGGG - Intronic
1050848717 9:10257577-10257599 CATATAAATCATTTTGATTTAGG - Intronic
1050875903 9:10635924-10635946 CATCTTTAACACTTTGATTTGGG + Intergenic
1051323512 9:15937654-15937676 CATAATTCTCATTATAATTTTGG + Intronic
1051388419 9:16537109-16537131 CAGATTTAACATAATTATTTAGG + Intronic
1051789188 9:20780717-20780739 AATATTTAGATTTATAATTTAGG + Intronic
1052012449 9:23426572-23426594 CATAGTGATCATTATTATTTAGG - Intergenic
1052149375 9:25095053-25095075 TATATTCAGCATCAAGATTTCGG - Intergenic
1053335427 9:37266195-37266217 CATATTAAGCATTTGCATTTGGG - Intronic
1053646634 9:40123879-40123901 CATATTTATCATAAGAATTTTGG + Intergenic
1053759084 9:41339688-41339710 CATATTTATCATAAGAATTTTGG - Intergenic
1054327642 9:63721765-63721787 CATATTTATCATAAGAATTTTGG + Intergenic
1056717678 9:89045974-89045996 CATGGTTGGCATTAAGATTTGGG + Intronic
1058069287 9:100585295-100585317 AATATTTGGGATTATGATTCAGG + Intronic
1059052205 9:110938549-110938571 TATATTTAGCATTAAGAGTGGGG + Intronic
1059079459 9:111233110-111233132 GATATTTAGCACTATTTTTTAGG - Intergenic
1059923261 9:119181063-119181085 CAAATTCAGCATTTTGCTTTGGG + Intronic
1061466023 9:130780434-130780456 CATATTTACCTTTGTGATATTGG + Intronic
1062223013 9:135429653-135429675 CATGTTTAGCTTTGTTATTTAGG - Intergenic
1202794424 9_KI270719v1_random:107313-107335 CATATTTATCATAAGAATTTTGG + Intergenic
1186337970 X:8612006-8612028 CAAATGTAGAAGTATGATTTAGG + Intronic
1187037500 X:15557157-15557179 GATATATATCATTATGGTTTAGG + Intergenic
1187610002 X:20932328-20932350 AATATTTAGAAATATAATTTAGG + Intergenic
1187657391 X:21492870-21492892 CAATTTTAGGATTTTGATTTAGG + Intronic
1188202606 X:27309572-27309594 CATATTTGGCAATATAACTTAGG - Intergenic
1188411525 X:29877852-29877874 CATTTTTTCCATGATGATTTTGG - Intronic
1188537828 X:31216973-31216995 TATATTTAGCCCTATGGTTTGGG + Intronic
1188636716 X:32442362-32442384 CATATTTCTCTTTAAGATTTTGG - Intronic
1188877441 X:35447576-35447598 CCTTTTTAGAATTATGATATTGG + Intergenic
1190534780 X:51415097-51415119 CATATTTAGTTTTATGATCTAGG + Intergenic
1191046909 X:56148232-56148254 CATATTTTGCTTTATTATGTAGG - Intergenic
1191652333 X:63553020-63553042 CATATTTATGATTATGATGATGG + Intergenic
1192328433 X:70153881-70153903 GATATTGAGCCTTTTGATTTTGG - Intronic
1194428421 X:93769502-93769524 CATCTTTAGAAGTTTGATTTTGG + Intergenic
1194934035 X:99925958-99925980 TAAATTTATCATTATTATTTTGG + Intergenic
1196204330 X:112921984-112922006 CATTTTTAAAATTCTGATTTTGG + Intergenic
1196760531 X:119196964-119196986 CAACTTTGGCATTATTATTTTGG + Intergenic
1198732431 X:139746732-139746754 CTTATTTAGCGTTCTGACTTAGG - Intronic
1199019693 X:142863527-142863549 TATATTTAGCATTTGGAATTAGG - Intergenic
1200160167 X:154003111-154003133 TTCACTTAGCATTATGATTTTGG - Intergenic
1201148907 Y:11084108-11084130 CATATTTATCATAAGAATTTTGG - Intergenic
1201402974 Y:13622879-13622901 CATTTTTGGCATTGCGATTTTGG + Intergenic
1202391173 Y:24371965-24371987 CTTACTTAGCATAATGATTAGGG + Intergenic
1202479611 Y:25298151-25298173 CTTACTTAGCATAATGATTAGGG - Intergenic