ID: 998785403

View in Genome Browser
Species Human (GRCh38)
Location 5:145703455-145703477
Sequence TTGAAACTGGGGCAGCTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998785403_998785408 7 Left 998785403 5:145703455-145703477 CCAAATAGCTGCCCCAGTTTCAA 0: 1
1: 0
2: 1
3: 14
4: 114
Right 998785408 5:145703485-145703507 ATGCTAACCCTAAATGCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 72
998785403_998785409 8 Left 998785403 5:145703455-145703477 CCAAATAGCTGCCCCAGTTTCAA 0: 1
1: 0
2: 1
3: 14
4: 114
Right 998785409 5:145703486-145703508 TGCTAACCCTAAATGCTCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998785403 Original CRISPR TTGAAACTGGGGCAGCTATT TGG (reversed) Intronic
901624207 1:10614470-10614492 TGGAAAGTGAGGCAGCTATTGGG + Intronic
906550442 1:46661827-46661849 TTTAAATTGTGGCAGCTCTTAGG - Intronic
908722934 1:67145842-67145864 TTGAATCTGGGGTAGCTCTGTGG + Intronic
916344471 1:163772342-163772364 TGGCAACTGAGGCAGCTATTTGG - Intergenic
921774040 1:219076600-219076622 TTGAAACTAGGCCATATATTTGG - Intergenic
923822481 1:237460383-237460405 TTGAAACTGGGTCAACTCCTTGG + Intronic
1064683583 10:17836037-17836059 GTGAAACTGGGGGAGCTTGTGGG + Intronic
1069145008 10:64880720-64880742 TGGAAGCTGGAGGAGCTATTTGG + Intergenic
1069793223 10:71036544-71036566 TTCTAACTGGGGGAGGTATTGGG + Intergenic
1071863586 10:89701456-89701478 TTGAAACGCGGGCAGCCAATGGG - Intergenic
1074876770 10:117619700-117619722 TTTAAACTGGGGCGGCAATTGGG + Intergenic
1078888008 11:15525231-15525253 TTGAAACTTGGCCGGGTATTAGG + Intergenic
1079162957 11:18011881-18011903 TTGAATGTGGGGCTGCAATTTGG - Intronic
1080786966 11:35484331-35484353 TTCAAACTGGGGATGGTATTAGG - Intronic
1081775359 11:45672400-45672422 TTGAAAATGGGGCTTCTATTGGG - Intergenic
1083182277 11:60994782-60994804 TAGGAACTGGGACAGGTATTCGG + Intronic
1083850986 11:65366761-65366783 TTGGAACTGGGGCAGCCCCTGGG - Intergenic
1083908905 11:65693712-65693734 TTGGAACTGGGTGAGTTATTTGG - Intergenic
1084590873 11:70089510-70089532 TTGAACCTGGGGCATCTGTCTGG + Intronic
1085103532 11:73822128-73822150 ATGAAACTGGGGCAGCAGTCAGG + Intronic
1099317257 12:81099984-81100006 GTGAGACTGGGGCATGTATTTGG - Intronic
1099898626 12:88680505-88680527 CTGAAAATGTGGAAGCTATTTGG + Intergenic
1104702786 12:130919849-130919871 TTGAAATTGGAGCAGTTAATTGG + Intergenic
1105487637 13:20852351-20852373 TTGCAACTGAGGCTGCTACTTGG - Intronic
1106698044 13:32199353-32199375 TGGAATATGTGGCAGCTATTAGG + Intronic
1107995783 13:45859701-45859723 TTGAAACTGGGCCAGAAATAGGG + Intergenic
1109474249 13:62857599-62857621 TTGATAAAGGGGCATCTATTTGG - Intergenic
1110330681 13:74268837-74268859 TGGAAGCTGAGACAGCTATTTGG + Intergenic
1113331776 13:109334305-109334327 TTGAATCTGGGGCAGAGAGTGGG + Intergenic
1114152818 14:20064059-20064081 ATGACAGTGGGGCAGCTCTTTGG - Intergenic
1115925579 14:38429652-38429674 TTGAAACTGTTTCAGCTATGAGG + Intergenic
1116656052 14:47655164-47655186 TTGCAACTGGGGCTTCTACTTGG - Intronic
1123115971 14:105894216-105894238 TTGGAACTGGGGCAGCTGTTGGG + Intergenic
1123402943 15:20004517-20004539 TTGGAACTGTGGCAGCTGTTGGG + Intergenic
1123512283 15:21011171-21011193 TTGGAACTGTGGCAGCTGTTGGG + Intergenic
1133560085 16:6942690-6942712 TTGACACTGGGGCATCTCTTTGG + Intronic
1135541701 16:23334851-23334873 TTGAAATTGGTGCAGTCATTTGG - Intronic
1143022364 17:3923431-3923453 TTCAAGCTGAGGCAGCTACTCGG + Intergenic
1143778675 17:9217636-9217658 TGGACACTGTGACAGCTATTTGG - Intronic
1148709191 17:49664705-49664727 TTGAACCTGGGGCAGGTATCTGG + Intronic
1149291915 17:55225724-55225746 CAGAAACTTGGGCAGCTTTTAGG - Intergenic
1155457494 18:26034096-26034118 TTGAAACTCAGTCAGATATTGGG - Intronic
1156854405 18:41765248-41765270 TAGAAACTAGGGCAGCTGCTGGG + Intergenic
1162928537 19:13943401-13943423 TGGAAACTGAGGCAGAGATTAGG - Intronic
1166721613 19:45000324-45000346 CTGAAAGAGGGGCAGCCATTTGG - Intergenic
925266118 2:2567724-2567746 TAGGAAATGGGGCAGCTAATGGG + Intergenic
925958977 2:8997066-8997088 TGGCAACTGGGGCAGCTGATGGG - Intronic
926314547 2:11699734-11699756 CTGAATCTGGGGCTGCTTTTAGG + Intronic
928377836 2:30790385-30790407 TTGCTGCTGGGGCAGCTCTTGGG + Intronic
928661900 2:33510495-33510517 ATGACACTGGAGCACCTATTAGG - Intronic
930016400 2:46973797-46973819 TTGAAACTGGGTGAGCAAGTTGG - Intronic
930641527 2:53859348-53859370 TTGAACCCGGAGCAGCTAATGGG + Intronic
930873553 2:56190257-56190279 ATGAAACAGGGGCAGCTACAGGG - Intronic
933571476 2:84018600-84018622 TTGAAATTGTGCCATCTATTAGG - Intergenic
941960674 2:171250327-171250349 GTGAAACTGGAGCAAGTATTAGG + Intergenic
943101059 2:183487094-183487116 TTGAAACTGGGTCATTTATAAGG + Intergenic
946704948 2:222449211-222449233 TTGAGGGTGGGGCTGCTATTTGG + Intronic
947016338 2:225624414-225624436 TGGAAACTGGGGCAAAAATTGGG + Intronic
947589080 2:231374715-231374737 TTAAAACTGGGGCTGGGATTAGG - Intronic
947916485 2:233835449-233835471 GGCAAACTGGGGCAGCCATTTGG + Intronic
1169884850 20:10387940-10387962 CTGAAAATGTGGCAGCAATTTGG + Intergenic
1170932062 20:20778028-20778050 TGGAAACTGGTGCAGCCATTTGG - Intergenic
1172031799 20:31987565-31987587 TTGATACTGGGGCCGCTTTGTGG - Intronic
1177830631 21:26134863-26134885 GTGATACTGTGGCATCTATTTGG - Intronic
1178212514 21:30552601-30552623 TGGGAACTGGTGCAGCTGTTTGG + Intronic
1181766757 22:25097939-25097961 CTGGAACTGTGGCAGCCATTTGG - Intronic
1182856924 22:33525839-33525861 TTGCAAATGGTGCAGCCATTTGG + Intronic
955294371 3:57721585-57721607 TTGAAACTGGGGGTGGTCTTGGG + Intergenic
957897460 3:86441974-86441996 TTGAAAATGCAGCAGCTATTTGG - Intergenic
964883864 3:161457785-161457807 TGAAAACTGGTGCAGCCATTAGG - Intergenic
965193789 3:165567365-165567387 TAGAAACTGGGGCTACTATCGGG + Intergenic
969975024 4:11089943-11089965 TTGGAACTATGGCAGCCATTGGG + Intergenic
971340296 4:25762598-25762620 CAGAATATGGGGCAGCTATTAGG + Intronic
974734989 4:65918760-65918782 TTGAAACTGAGGGTGGTATTGGG - Intergenic
975395183 4:73867290-73867312 TTGAAACTGATGAAGATATTTGG + Intergenic
981389353 4:144170565-144170587 TTTCAACTAAGGCAGCTATTGGG + Intergenic
981761272 4:148197963-148197985 TTGAGGTTGGGGCAGCTTTTTGG + Intronic
987864813 5:23525299-23525321 TGGAAACTGGAGCAGCTCTGAGG - Intronic
992330453 5:75712072-75712094 TTCAAAATGGGGAAGGTATTGGG - Intronic
992482988 5:77169462-77169484 GTGACACTGAGGCTGCTATTTGG + Intergenic
994549708 5:101216189-101216211 TGTAAAATGGTGCAGCTATTTGG + Intergenic
995241460 5:109889553-109889575 ATTAAACTGGGGCAGCTTCTGGG - Intergenic
996233160 5:121091497-121091519 TTTAACCTGTGGCAGCTAGTGGG + Intergenic
998785403 5:145703455-145703477 TTGAAACTGGGGCAGCTATTTGG - Intronic
1002213800 5:177613781-177613803 TTGTAGCTGAGGGAGCTATTAGG + Intergenic
1008609822 6:53175468-53175490 TTGACACTGGGGCTGCTCTCCGG - Intergenic
1011007980 6:82669479-82669501 TTGAAACTGAGTCAGATATCTGG - Intergenic
1012695970 6:102384199-102384221 TTAAAATTGTGGTAGCTATTAGG + Intergenic
1012962205 6:105634082-105634104 TAGGAGCTGGGGCAGGTATTTGG + Intergenic
1017276804 6:152579207-152579229 TTGAATTTGGGTGAGCTATTGGG + Intronic
1019559781 7:1650304-1650326 CAGAAAATGGGGCAGCTACTGGG - Intergenic
1019975647 7:4579209-4579231 TTGAAACTGGGCCAGCCTCTGGG + Intergenic
1020535768 7:9395900-9395922 TTTAAAATGGGGCAGTTATTTGG - Intergenic
1021575321 7:22100973-22100995 CTGCAACTGGGGCTACTATTTGG + Intergenic
1023578664 7:41657769-41657791 CTGAAACTGGGGCAGGCAGTTGG + Intergenic
1024011648 7:45271944-45271966 TTGAAACTGGGGAGGCTCTTTGG - Intergenic
1024788221 7:52932530-52932552 TTTAAACTGGGACAGTTCTTGGG - Intergenic
1025623207 7:63193228-63193250 TTGAAACTAGGGCATCTTTATGG + Intergenic
1026401861 7:70022198-70022220 TTGGATTTGGGGCAGCTATGAGG - Intronic
1027176364 7:75906329-75906351 GTGAAACTGGGGCGGGTATGCGG + Intronic
1032496637 7:132367903-132367925 GGGAACCTGGGCCAGCTATTTGG - Intronic
1036412526 8:8515579-8515601 TTGAAGCTGGTGCAGCTCTCTGG + Intergenic
1037002853 8:13741730-13741752 TTGAAACAGCAGTAGCTATTTGG + Intergenic
1038303643 8:26379243-26379265 CTGAAAATGTGGCAGCAATTTGG - Intergenic
1038724240 8:30066027-30066049 TGGAGGCTCGGGCAGCTATTCGG - Exonic
1042478778 8:69280258-69280280 TAGAAAATGGGGCAGCCATTTGG + Intergenic
1042765318 8:72314936-72314958 TGGAAACTGGGACTGCCATTTGG + Intergenic
1043139674 8:76572639-76572661 TTCAAACCGGGGCAGCAATCAGG - Intergenic
1045283841 8:100772993-100773015 TTGAAAGCGGGGCAGCCAGTAGG - Intergenic
1046853332 8:119000728-119000750 TTAAAAATGGGCCAGTTATTAGG + Intronic
1053634123 9:39977692-39977714 TTGAAACAATGGAAGCTATTGGG - Intergenic
1053771625 9:41485811-41485833 TTGAAACAATGGAAGCTATTGGG + Intergenic
1054209764 9:62273005-62273027 TTGAAACAATGGAAGCTATTGGG + Intergenic
1054315227 9:63575949-63575971 TTGAAACAATGGAAGCTATTGGG - Intergenic
1054776947 9:69131867-69131889 TTGAAACTGGGGGTGGTCTTGGG - Intronic
1055282748 9:74693423-74693445 TTGTAACTTGGTAAGCTATTTGG - Intergenic
1055575690 9:77658523-77658545 TTGAAACTGGGCAAGCTATGTGG + Intergenic
1056138531 9:83651992-83652014 TGTAAAATGGGGCAGCTACTTGG - Intergenic
1058459768 9:105172172-105172194 TTGAAACTGGCGCAGATGGTTGG + Intergenic
1058979045 9:110152307-110152329 TTGAAAATGGGGCAGATTTCAGG + Intronic
1186014394 X:5174697-5174719 TTGAAAGTGGGTCAACTGTTGGG - Intergenic
1186890147 X:13951573-13951595 TTGCAACTGGGGCAGATCCTAGG - Intergenic
1188521364 X:31042054-31042076 CTGAGACTGGGGCTGCAATTTGG - Intergenic
1188952491 X:36393272-36393294 TTGGAACTGAAGAAGCTATTTGG + Intergenic
1190397691 X:50001352-50001374 TAGAAACTGGAGGAGCTTTTTGG - Intronic
1191790959 X:64971402-64971424 TGGAGAGTGGGGCAGGTATTGGG + Intronic
1192369430 X:70500953-70500975 ATGAAACTGGAGCAGGAATTTGG + Exonic
1195396146 X:104412408-104412430 TTGCAGCTGTGGCAGCTATGAGG + Intergenic
1197275553 X:124475036-124475058 TTGAAACTGGGCTAGGAATTTGG + Intronic
1198096764 X:133387858-133387880 TAGAAACTGAAGAAGCTATTGGG - Intronic