ID: 998785777

View in Genome Browser
Species Human (GRCh38)
Location 5:145707291-145707313
Sequence CTCCCTCTTGATTTTGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998785774_998785777 -1 Left 998785774 5:145707269-145707291 CCCCAATGATCGTGACTGCACTC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 998785777 5:145707291-145707313 CTCCCTCTTGATTTTGTGTCAGG No data
998785776_998785777 -3 Left 998785776 5:145707271-145707293 CCAATGATCGTGACTGCACTCTC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 998785777 5:145707291-145707313 CTCCCTCTTGATTTTGTGTCAGG No data
998785775_998785777 -2 Left 998785775 5:145707270-145707292 CCCAATGATCGTGACTGCACTCT 0: 1
1: 0
2: 0
3: 4
4: 46
Right 998785777 5:145707291-145707313 CTCCCTCTTGATTTTGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998785777 Original CRISPR CTCCCTCTTGATTTTGTGTC AGG Intronic
No off target data available for this crispr