ID: 998788344

View in Genome Browser
Species Human (GRCh38)
Location 5:145737576-145737598
Sequence CTGTGCTTGTTGCTGTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 1, 2: 4, 3: 38, 4: 367}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998788344_998788346 -2 Left 998788344 5:145737576-145737598 CCTGAAAACAGCAACAAGCACAG 0: 1
1: 1
2: 4
3: 38
4: 367
Right 998788346 5:145737597-145737619 AGATAATTTTTTAAAAAGGATGG 0: 1
1: 2
2: 16
3: 202
4: 1384
998788344_998788348 20 Left 998788344 5:145737576-145737598 CCTGAAAACAGCAACAAGCACAG 0: 1
1: 1
2: 4
3: 38
4: 367
Right 998788348 5:145737619-145737641 GTCTCTCCAGGCAAAAGACCAGG 0: 1
1: 0
2: 4
3: 25
4: 224
998788344_998788345 -6 Left 998788344 5:145737576-145737598 CCTGAAAACAGCAACAAGCACAG 0: 1
1: 1
2: 4
3: 38
4: 367
Right 998788345 5:145737593-145737615 GCACAGATAATTTTTTAAAAAGG 0: 1
1: 0
2: 14
3: 86
4: 748
998788344_998788347 8 Left 998788344 5:145737576-145737598 CCTGAAAACAGCAACAAGCACAG 0: 1
1: 1
2: 4
3: 38
4: 367
Right 998788347 5:145737607-145737629 TTAAAAAGGATGGTCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998788344 Original CRISPR CTGTGCTTGTTGCTGTTTTC AGG (reversed) Intronic
900528076 1:3138878-3138900 CCGGGTGTGTTGCTGTTTTCTGG + Intronic
901109310 1:6782925-6782947 CTGTTTTTGTTGTTGTTTTTTGG - Intergenic
901579387 1:10228291-10228313 CTGTTTTATTTGCTGTTTTCAGG + Intronic
904836424 1:33340468-33340490 CTGTGTTTGCTGCTGTCTCCTGG - Intronic
906963257 1:50432303-50432325 CTGTGCTTCTTCCTATTTACTGG - Intergenic
908185350 1:61647439-61647461 TTGTTGTTGTTGTTGTTTTCTGG - Intergenic
909194556 1:72601383-72601405 CTGTTTTTGTTTCTGTTTTGAGG + Intergenic
911083350 1:93955399-93955421 TTGTTGTTGTTGTTGTTTTCTGG + Intergenic
912028655 1:105210814-105210836 CTTTTCTTATTTCTGTTTTCAGG - Intergenic
914349299 1:146826545-146826567 CTGTGTCTGTTGATGTTTTAGGG - Intergenic
916126044 1:161572299-161572321 CTGTTCTTGTTGATTTTTTCAGG + Intergenic
916135959 1:161654146-161654168 CTGTTCTTATTGATTTTTTCAGG + Intronic
918114296 1:181483672-181483694 TTCTGCTTGTTGCTGTGTGCGGG + Intronic
918230176 1:182522473-182522495 CTTTGCCTGTTTGTGTTTTCTGG + Intronic
918262942 1:182812740-182812762 CTGTTCTTGTTCCTATATTCTGG - Intronic
918280269 1:182997669-182997691 CTGTTGTTGTTGTTGTTTTTTGG + Intergenic
919397100 1:197064697-197064719 CTGTGATTTTTGCATTTTTCTGG + Intronic
919486059 1:198148502-198148524 CTGTGCATCATGTTGTTTTCAGG + Intergenic
919954331 1:202397809-202397831 CTATGCATGTAGCTATTTTCTGG + Intronic
920270682 1:204761324-204761346 CTGAGCTTGGAGCTATTTTCTGG + Intergenic
920633215 1:207672814-207672836 CTGTGCTTTGTGATGTATTCTGG + Intronic
921523463 1:216187055-216187077 ATGTGCTAGTTTCTGTTTTAGGG - Intronic
921881103 1:220255221-220255243 ATGTTGTTGTTGTTGTTTTCTGG - Intronic
923358648 1:233185603-233185625 CAGTGCTTGTTGCCTATTTCAGG + Intronic
1063539999 10:6923161-6923183 ATGTTCTTGTTGCTGTTATGAGG + Intergenic
1063805398 10:9633774-9633796 CTGTAGTTGTTGGTATTTTCAGG + Intergenic
1063889302 10:10613286-10613308 CTCTGCTTTTTGGTATTTTCTGG - Intergenic
1064078812 10:12291701-12291723 CTGTGGTTGTTGTTTTGTTCTGG + Intergenic
1064296158 10:14080611-14080633 CTGTGATTGTAGCTGTGTCCAGG - Intronic
1064332401 10:14406101-14406123 CTGTTGTTGTTGTTGTTTTGAGG + Intronic
1064736749 10:18389493-18389515 TTGTTTTTGTTGTTGTTTTCTGG + Intronic
1065139681 10:22708230-22708252 CTGTGCTTGTGGTTGATTGCGGG - Intronic
1067728607 10:48792279-48792301 CTGAGCATGTGGCTGTTTCCTGG + Intronic
1068095652 10:52487941-52487963 TTGTTGTTGTTGTTGTTTTCTGG + Intergenic
1068692707 10:59933455-59933477 CTGTACTTTTTCCTCTTTTCTGG - Intergenic
1069011552 10:63379360-63379382 CTATTGTTATTGCTGTTTTCTGG - Intronic
1070687385 10:78498141-78498163 GTGTTCTTGTTGCTGTTTCCTGG + Intergenic
1071047457 10:81399432-81399454 TTGTGGTACTTGCTGTTTTCTGG - Intergenic
1072262707 10:93696271-93696293 CCGTGCCTGTTGGTGTTTCCGGG - Intronic
1072359578 10:94646759-94646781 CTGGGCATGTTGGTGTGTTCTGG - Intergenic
1072392848 10:95006304-95006326 CTTGTCTTGTTCCTGTTTTCAGG + Intergenic
1072621463 10:97082164-97082186 CTGTGCTTGCATCTGTGTTCAGG - Intronic
1072630123 10:97139968-97139990 CTCTGCTTTGTGCTGATTTCTGG + Intronic
1073187086 10:101621740-101621762 CTGTGCCTCTTGCTGTGATCTGG - Intronic
1075174471 10:120146415-120146437 GTGTGCCTCTTGCTGATTTCTGG - Intergenic
1076855586 10:133114133-133114155 CTGGGCTTGGTGCTGTTCCCAGG - Intronic
1078528263 11:12117152-12117174 CTGTGCTTCCTGCTGGTTTGGGG + Intronic
1080342076 11:31276011-31276033 CTGTGATTGCTACAGTTTTCTGG - Intronic
1080514090 11:33003846-33003868 CTGTGCCCATTGGTGTTTTCAGG + Intergenic
1082079103 11:47998064-47998086 CTGTGCTAGGAGCTGTTTTTGGG - Intronic
1083344116 11:61977593-61977615 TTTTGCTTTTTGCTTTTTTCTGG + Intergenic
1083861043 11:65420127-65420149 CTCTGTTTGCTGCTGTTTTCTGG + Intergenic
1084522689 11:69674259-69674281 CTGTGTATGTTGCAGTTTTTTGG - Intronic
1087344270 11:96950818-96950840 CTATGCTTGGTGCTGTTGACAGG - Intergenic
1087871244 11:103295359-103295381 CTGTGCCTGTTGCTGCTTCTAGG - Intronic
1088498459 11:110456896-110456918 CAGTGTTTGTTGCTTTTGTCAGG + Exonic
1089434653 11:118454376-118454398 CTGTGCCTGTTGCTGTCTTGGGG + Intronic
1090101086 11:123797533-123797555 CTGTGCCTGTTGCTGCTTCTGGG + Intergenic
1092455410 12:8638315-8638337 CATTGCTTGTTTCTTTTTTCTGG - Intronic
1092901772 12:13066646-13066668 CTGTGCTTTCTGCTGGTGTCTGG + Exonic
1092919586 12:13219151-13219173 CTGTGCTTTATGCTGATGTCAGG + Exonic
1094247173 12:28311841-28311863 TTGTGCCTGTTGGTGTTTCCTGG + Intronic
1095219800 12:39596829-39596851 CTGTGGATTTTGGTGTTTTCTGG - Intronic
1095998229 12:48107080-48107102 CTGTGCCTGTGGCTGTGATCTGG - Intronic
1096305916 12:50475402-50475424 GAGTGCTTGTTGCCCTTTTCTGG + Intronic
1098091634 12:66908328-66908350 CTGGACTTTTTGCTGTTCTCTGG - Intergenic
1100213809 12:92427015-92427037 TTGTTGTTGTTGTTGTTTTCTGG + Intronic
1100369966 12:93959573-93959595 CTTGTCTTGTTGCTGTTCTCAGG - Intergenic
1101751068 12:107582767-107582789 CTGTGCTGCCTCCTGTTTTCAGG + Intronic
1102392931 12:112564010-112564032 CTCTCTTTGTTGCTCTTTTCTGG + Intergenic
1105412768 13:20185057-20185079 CTGTGCTTGTTACCGGCTTCAGG + Intergenic
1106240169 13:27905717-27905739 CTGTGGTTACTGCTATTTTCTGG - Intergenic
1106671548 13:31911501-31911523 CTGTTTTTGTTTTTGTTTTCTGG - Intergenic
1107297861 13:38932332-38932354 CTGTTTTTGTTACTGTTTCCTGG + Intergenic
1107525442 13:41226783-41226805 CTGTGGATGCTGCTGCTTTCTGG - Intronic
1107962877 13:45574660-45574682 CTGTGCTTGTTGGAGTTTCTGGG + Intronic
1108417553 13:50213962-50213984 TTCTGCTTGTTACTGTTTGCTGG - Intronic
1108428268 13:50327040-50327062 CTTTTTATGTTGCTGTTTTCAGG + Intronic
1109567617 13:64138216-64138238 TTTTGCTTGTTGCTTTTTTTTGG + Intergenic
1112626465 13:101110065-101110087 CTGTGCTGGGTTCTGTTTTAAGG - Intronic
1113251214 13:108455035-108455057 CTGTTTTTTTTTCTGTTTTCAGG + Intergenic
1113551782 13:111198191-111198213 CTGTGCTAGTTGCTTTTAACTGG + Intronic
1114053819 14:18948207-18948229 CTTTGCTTGTAGCGGTTTTATGG - Intergenic
1114108736 14:19453718-19453740 CTTTGCTTGTAGCGGTTTTATGG + Intergenic
1116129832 14:40840695-40840717 TTCTACTTATTGCTGTTTTCAGG + Intergenic
1117704915 14:58455346-58455368 CTGTGCTTTTTTCTGTGTTTGGG + Intronic
1118226844 14:63909009-63909031 TTTTGGTTGCTGCTGTTTTCTGG + Intronic
1119373627 14:74169387-74169409 GTATTCTGGTTGCTGTTTTCTGG + Intronic
1121879207 14:97485023-97485045 GTGTTCCTGTTGTTGTTTTCAGG + Intergenic
1123179014 14:106450214-106450236 CTTTTCTTGTTCCAGTTTTCAGG + Intergenic
1202858503 14_GL000225v1_random:65467-65489 CTGTGGGTGTTGCTGTTGTCTGG + Intergenic
1123395942 15:19935661-19935683 CTGTGCTTTTTTCTTTTTTAAGG + Intergenic
1124183072 15:27496451-27496473 CTGTACTTGTTGGTGCTTCCAGG + Intronic
1125255176 15:37755119-37755141 CTTTGCTTGTTCCTGTGTGCAGG - Intergenic
1126197286 15:45946458-45946480 GTGTGGCTGTTGATGTTTTCAGG - Intergenic
1127332691 15:57954459-57954481 CTGAGCTTGCTGCAGTTTTGGGG - Exonic
1127542957 15:59961174-59961196 CTGTGTTTGTTGATTTTTTTTGG - Intergenic
1127646204 15:60961861-60961883 CTGTGTCAGTTACTGTTTTCAGG - Intronic
1128105524 15:65041814-65041836 CTGCCCTTGCTACTGTTTTCTGG + Intergenic
1128881033 15:71242971-71242993 CCGTGGTTGTTGCTTGTTTCTGG - Exonic
1129877780 15:78987974-78987996 CAGTTCTATTTGCTGTTTTCTGG - Intronic
1129981780 15:79878806-79878828 CTGTGCTTGTTGCTGCCTCTGGG + Intronic
1130720414 15:86380968-86380990 CTGTGCTTGTTTCTAATTACTGG + Intronic
1130738507 15:86573909-86573931 TTGTGATTTTTGTTGTTTTCAGG - Intronic
1130953126 15:88607543-88607565 TTGTTATTGTTGCTGTTTTTCGG - Intergenic
1131394903 15:92078422-92078444 CTGTGCTTCTTGCTGTAGGCAGG + Intronic
1131772608 15:95755658-95755680 CTGTGCTTTTCATTGTTTTCTGG - Intergenic
1133517296 16:6521695-6521717 TTTTTCTTGTTGTTGTTTTCTGG - Intronic
1135769456 16:25206026-25206048 TATTGCTTGTTCCTGTTTTCCGG + Intergenic
1137741852 16:50784489-50784511 GTGTTCTATTTGCTGTTTTCTGG + Intronic
1139984737 16:70889009-70889031 CTGTGTCTGTTGATGTTTTAGGG + Intronic
1141308039 16:82885281-82885303 TTCTTCTTTTTGCTGTTTTCAGG - Intronic
1141475185 16:84268181-84268203 TTGTTGTTGTTGTTGTTTTCTGG - Intergenic
1203071612 16_KI270728v1_random:1082138-1082160 CTGTGCTTTTTTCTTTTTTAAGG - Intergenic
1143935006 17:10474610-10474632 CTGAGCTTGGTGCTTTTTTAGGG + Intergenic
1144164600 17:12597176-12597198 GTGTGCTTATTGGTGGTTTCTGG + Intergenic
1144191502 17:12850740-12850762 CTGTGCTTGTTAAGGTTTTGGGG - Intronic
1145692561 17:26758070-26758092 CTGTGCTTTTTTCTTTTTTAAGG + Intergenic
1145803869 17:27712545-27712567 CTGTGCTGGTTGCTTTTAACTGG - Intergenic
1146822393 17:35994104-35994126 CTGTGCTTGTAGCTTTATCCTGG - Intronic
1146902529 17:36598019-36598041 CTGTGCCTGTGGCTGGTCTCCGG + Intronic
1148070323 17:44904875-44904897 GTGTGCTAGTTGCTGGCTTCCGG + Exonic
1148241172 17:46000300-46000322 TTGTGCTTTTCTCTGTTTTCAGG + Intronic
1149875085 17:60224573-60224595 CTGTGCTGGTTGCAGTCTTCTGG - Intronic
1150185581 17:63177712-63177734 CTGTGATTGTTTCTGGGTTCAGG + Intronic
1150930701 17:69581603-69581625 CTTGCCTTGTTGCTGTCTTCAGG + Intergenic
1151135585 17:71943245-71943267 TTGTTGTTGTTGTTGTTTTCTGG - Intergenic
1152373804 17:79907310-79907332 CTGCCCTTGTTGCTTTTTTATGG + Intergenic
1153890225 18:9507135-9507157 CTATGCTTGTTGGTGTTTCTGGG + Intronic
1153999950 18:10474415-10474437 CCGTGCTTTTTGGTGTTTTGAGG - Intronic
1155578401 18:27275422-27275444 CTGCTCTTGTTGCACTTTTCGGG - Intergenic
1155779011 18:29807188-29807210 CTGTGCTTTCTGCTGTTTTTGGG - Intergenic
1156182861 18:34626082-34626104 TTGTGATTATTGCTTTTTTCAGG + Intronic
1156194693 18:34760830-34760852 GTGTGCTTGTTGATAATTTCTGG + Intronic
1157220836 18:45827552-45827574 CTCTGCTGTTTGCTGTTTACTGG + Intronic
1158499318 18:57985847-57985869 CTGTGCATTTTACAGTTTTCTGG - Intergenic
1159874119 18:73791378-73791400 TTGTGGTTGTTGCTGTTTAGTGG - Intergenic
1162564599 19:11438427-11438449 CTGTGGGTGTTTCGGTTTTCAGG - Intronic
1163515163 19:17758429-17758451 CTTTGCTATTTGCTGTTTTGTGG + Intronic
1163790753 19:19304915-19304937 CTGACCTGGTTGCTGTTTACAGG + Intronic
1165849677 19:38842505-38842527 CTGTGCTTGTAGCTGTTCCTTGG + Intronic
1166445767 19:42856356-42856378 CTGTGCTGGTTGCTCTTTGGGGG + Intronic
1166458790 19:42967921-42967943 CTGGTCTTGTTTCTGTTCTCTGG + Intronic
1166475736 19:43123192-43123214 CTGGTCTTGTTTCTGTTCTCTGG + Intronic
1167802659 19:51754914-51754936 CTTTGCTTGTGGCTGTTTTCAGG - Intronic
1167850502 19:52197671-52197693 TTGTGCTTGTTGTTGTTTTGAGG - Intronic
1168138723 19:54370105-54370127 CTGTACTTCTTGCTGTTTTCAGG + Intronic
1168159305 19:54498392-54498414 CTGTACTTCTTGCTGTTTTCAGG - Intronic
1168436951 19:56325739-56325761 TTGTTGTTGTTGCTGTTTTCAGG + Intronic
1202682569 1_KI270712v1_random:20985-21007 CTGTGCTTTTTCCTTTTTTAAGG + Intergenic
925168035 2:1731039-1731061 CTTTGCTTGCTTCTGTGTTCTGG - Intronic
925667615 2:6277592-6277614 CTCTGTTTGCTGCTTTTTTCTGG + Intergenic
927211213 2:20640294-20640316 CTGTGGTTGTTTCTGTTCTAAGG + Intronic
927417350 2:22892883-22892905 GTTTGCTTGTTGCTGTTAACTGG + Intergenic
928220244 2:29397343-29397365 CTGTGCTTCTAGTGGTTTTCTGG - Intronic
929124426 2:38510493-38510515 ATCTTCTTGTTGCTGTTTTTTGG + Intergenic
931138132 2:59427393-59427415 CTTTGCTTGTAGCATTTTTCAGG - Intergenic
931858818 2:66332423-66332445 CTGTGCTTCTATGTGTTTTCTGG + Intergenic
932744419 2:74320984-74321006 CTGTTTCTATTGCTGTTTTCAGG - Intronic
933789942 2:85875794-85875816 CTGTTCTTCTTTCTGTTTCCCGG + Intronic
934249234 2:90334187-90334209 CTGTGCTTTTTCCTTTTTTAAGG - Intergenic
934260345 2:91469283-91469305 CTGTGCTTTTTCCTTTTTTAAGG + Intergenic
934467812 2:94281433-94281455 CTGTGCTTTTTTCTTTTTTAAGG - Intergenic
934546420 2:95220367-95220389 CTGTGCCTGTTGGCGTTTCCGGG + Intronic
934900034 2:98152356-98152378 CTGGGCTTGATGCTGTTTTGGGG + Intronic
936026613 2:109035533-109035555 CTGTGCCTGCTGGTGGTTTCTGG - Intergenic
936442519 2:112567308-112567330 TTGTTGTTGTTGTTGTTTTCAGG + Intronic
937076538 2:119111452-119111474 CTGTGCCTGTTGCTGTCTACTGG - Intergenic
937310282 2:120898078-120898100 CTTTTCTTGTTGCTGTTTTGTGG + Intronic
937426243 2:121801435-121801457 CTGTGCCTGTTAATGGTTTCAGG - Intergenic
937863446 2:126730967-126730989 CTGTGATTAGTGCTGTTATCTGG - Intergenic
938518957 2:132046594-132046616 CTGTGCTTTTTTCTTTTTTAAGG - Intergenic
938904502 2:135825663-135825685 CTGGGCTTGAGGCTGTTCTCAGG + Intronic
940292533 2:152091184-152091206 CTGTGCTTCTTCTTGTTTTGGGG - Intronic
940491606 2:154369005-154369027 TTGTTGTTGTTGTTGTTTTCAGG + Intronic
940507056 2:154569412-154569434 CTGTCATTGTTTTTGTTTTCAGG - Intergenic
940853888 2:158714837-158714859 CTGTGCTTGTTGCTGTTTCCAGG + Intergenic
941281452 2:163556778-163556800 GTGTGCGTGGTGCTATTTTCAGG - Intergenic
941294513 2:163719517-163719539 TAGTGCTTGTTGCTATTTACTGG + Intronic
941711641 2:168720415-168720437 CTGTGATAGTTGTTCTTTTCTGG - Intronic
941742460 2:169049537-169049559 CTGAGTTTCTTTCTGTTTTCTGG - Intergenic
943158280 2:184213315-184213337 CTTGTCTTGTTCCTGTTTTCAGG + Intergenic
943328200 2:186526640-186526662 ATGTTTTTGTTGTTGTTTTCAGG + Intergenic
943502140 2:188705479-188705501 CTGTGCTCATTTCTGTTTTTGGG - Intergenic
944267542 2:197745624-197745646 TTGTTCTTTTTGTTGTTTTCTGG - Intronic
945787652 2:214262478-214262500 CTGTGGTGGTTGCTGTTTTGTGG - Intronic
946207634 2:218121351-218121373 CTGTGCTAGTTGCTTTTAACTGG + Intergenic
946246907 2:218393051-218393073 CCGTGCTCGTGGCTGTCTTCCGG + Exonic
947025187 2:225730279-225730301 CTGTGCTTTTGGCAGATTTCTGG + Intergenic
947286017 2:228515723-228515745 TTGTTTTTGTTGTTGTTTTCTGG - Intergenic
947698110 2:232209846-232209868 CTGTGATTTGTGCTGTTTCCAGG + Intronic
949008570 2:241665488-241665510 TTGTGGTTGTTGCTGCTTTGTGG + Intronic
949052900 2:241906794-241906816 CTGTGCTTGTTGCTGCCTCTAGG + Intergenic
1169594817 20:7186105-7186127 CTGTGCCTGTTAATGTTTTTGGG - Intergenic
1170534731 20:17328906-17328928 CTCTGCTGTTTGCTGTGTTCTGG - Intronic
1170732757 20:18988732-18988754 CTGTGGTTGTTTCTCTTTGCTGG + Intergenic
1171961009 20:31494222-31494244 CTGTGCTTGCTTCTATCTTCTGG + Intergenic
1171984107 20:31647335-31647357 CTGTTCTTGCTCCTGTTTTTTGG - Intergenic
1172002467 20:31790127-31790149 TTGTTGTTGTTGCTGTTTTATGG + Intronic
1174127428 20:48317344-48317366 CTGTGCTTGTTGGCATTTCCAGG - Intergenic
1174454410 20:50639254-50639276 CTGGCATTATTGCTGTTTTCAGG - Intronic
1174472383 20:50770475-50770497 CTGACATTATTGCTGTTTTCAGG + Intergenic
1175459928 20:59144941-59144963 CAGTGCTTGTTCCTGTTACCTGG + Intergenic
1176586051 21:8586892-8586914 CTGTGCTTTTTTCTTTTTTAAGG + Intergenic
1176958750 21:15136179-15136201 CTGTGCTTATTGCTATTTTATGG - Intergenic
1177103909 21:16931359-16931381 CTGAGCTTGTAGCTATTTACTGG - Intergenic
1178766829 21:35461842-35461864 CTGTACATGTAGCTGTCTTCTGG - Intronic
1178819115 21:35959284-35959306 TTGTTGTTGTTGTTGTTTTCAGG + Intronic
1179502722 21:41820174-41820196 CTGAGCTTGTCTCTGGTTTCAGG - Exonic
1180268859 22:10563798-10563820 CTGTGCTTTTTTCTTTTTTAAGG + Intergenic
1180280685 22:10691013-10691035 CTGTGCTTTTTTCTTTTTTAAGG + Intergenic
1180472289 22:15670588-15670610 CTTTGCTTGTAGCGGTTTTATGG - Intergenic
1181629649 22:24143870-24143892 CAGTGCTTATGGCTGTTTTCAGG + Intronic
1181921540 22:26324610-26324632 CTGTGATTTTTGCTGATATCTGG - Intronic
1184637546 22:45846325-45846347 CTGTTCTTGTTTTTGTTTTTAGG + Intergenic
1184703858 22:46196722-46196744 TTGTTGTTGTTGCTGTTTTGAGG + Intronic
1184801165 22:46761007-46761029 CTTTGCTAGCTACTGTTTTCAGG - Intergenic
1184853729 22:47135417-47135439 CTGTGCTTGTGCTTATTTTCTGG - Intronic
1203289877 22_KI270735v1_random:25847-25869 CTGTGCTTTTTTCTTTTTTAAGG - Intergenic
949263803 3:2134173-2134195 CAGTGCTTGCTGCAGTTTTAAGG + Intronic
950049555 3:9976663-9976685 CTCTCCTTATTGCTGTTCTCAGG - Intronic
953242747 3:41164311-41164333 GTGTGCTTCCTGCTGTTTTCAGG - Intergenic
954099275 3:48357107-48357129 GTGTGCCTGTTGGTGTTTTGGGG - Intergenic
954203519 3:49040066-49040088 CTTTTTTTGTTGCTGTTTTTTGG - Intronic
954811341 3:53250230-53250252 CTGGGCCTGTTTCTGTTTTTGGG - Intronic
955633535 3:61000758-61000780 CTCTCCCTGTTGCTGTTTTGGGG - Intronic
955929533 3:64042580-64042602 CTGAGCTTGTTGCTCTTTTGTGG - Intergenic
956278044 3:67524887-67524909 CTGTGCCTGTTAATGTTTTTGGG - Intronic
956734775 3:72229908-72229930 CTTTCCTTATTGATGTTTTCTGG + Intergenic
957012542 3:75024657-75024679 TTTTGGTTGTTGCTGTTTTCAGG + Intergenic
957461393 3:80525784-80525806 GTGTGCTTCTGCCTGTTTTCTGG + Intergenic
958009232 3:87854926-87854948 TTGTTGTTGTTGCTGTTTTTTGG + Intergenic
961586919 3:127937167-127937189 TTGTTGTTGTTGTTGTTTTCTGG - Intronic
961684630 3:128621125-128621147 CTGTCCTTAGTGCTGTTTTCTGG - Intronic
962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG + Intergenic
962415023 3:135174014-135174036 CTGTTCTTGTTGCAGTACTCCGG + Intronic
964262631 3:154856821-154856843 CTGTGATTCTTGGTCTTTTCTGG - Intergenic
965419097 3:168434914-168434936 GTGTGCTTGTTGCTGTTGTTTGG - Intergenic
965656763 3:170994851-170994873 TTGTTGTTGTTGTTGTTTTCAGG + Intergenic
965703192 3:171479450-171479472 TTGTATTTGTTGCTGTATTCAGG - Intergenic
968322609 3:197784206-197784228 CTGTACTTTTTGGTGTTTTTTGG + Exonic
968672341 4:1858267-1858289 CTGTGCTAGTGCCTGTTTACAGG + Intergenic
969081254 4:4620134-4620156 TTTTTCTTGTAGCTGTTTTCTGG + Intergenic
969111483 4:4847024-4847046 CTGGGCTTACTTCTGTTTTCTGG + Intergenic
970332475 4:15001725-15001747 CTAAGCTTGTTTCTGTTTTTAGG - Intergenic
970835237 4:20396683-20396705 CTGTGCTTTTTTCTCTTTTCTGG + Intronic
973239042 4:47937617-47937639 TTGTCCTTGTTTCTGTTCTCTGG + Exonic
974008101 4:56580547-56580569 CTTTGCTTGTTCCTGATGTCAGG - Intronic
974562717 4:63542021-63542043 CTGTGCTTGTTCCTGTCATTAGG + Intergenic
975904341 4:79191749-79191771 CTTTGCCTGTTCCTATTTTCAGG + Intergenic
976858015 4:89627887-89627909 CTCTGGTGGTTGCTCTTTTCTGG - Intergenic
976898950 4:90149353-90149375 ATTTTATTGTTGCTGTTTTCAGG + Intronic
978959530 4:114659426-114659448 CTATGAGTGTTGCTGATTTCTGG + Intronic
979195067 4:117911423-117911445 CTTTTCTTGTTCCTGTTTTCAGG + Intergenic
980398259 4:132244418-132244440 CTGAGTTTCTTCCTGTTTTCTGG + Intergenic
981372402 4:143973810-143973832 CTGGGCTTGTTTCAGTTCTCAGG + Intergenic
981381488 4:144077013-144077035 CTGGGCTTGTTTCAGTTCTCAGG + Intergenic
981497060 4:145405750-145405772 CTGTCCTTGGTGATGTTTTATGG + Intergenic
982740442 4:159052366-159052388 TTGTTGTTGTTGTTGTTTTCAGG - Intergenic
982979391 4:162112874-162112896 TTGTTCTTGTTGTTGTTTTGTGG + Intronic
986418774 5:7555380-7555402 TTGTGCTTGTTTGTGTTTTCGGG + Intronic
989998258 5:50861294-50861316 CTGTGTCTGTTGATGTTTCCAGG + Intergenic
990952852 5:61315134-61315156 TTGTTATTGTTGCTGTTTTTAGG + Intergenic
991146306 5:63309175-63309197 CTGTGTTTGTAGCTGTTACCTGG + Intergenic
992841194 5:80696483-80696505 CTGTGCCTGTTGGTCTTTCCGGG + Intronic
993114823 5:83707657-83707679 CTTTGCCTGTTCCTGTTTCCAGG - Intronic
995076416 5:107990106-107990128 CTGTGGTTGTTGCTTTCTTCTGG + Intronic
996187720 5:120499423-120499445 CTCTTTTTGTTGTTGTTTTCAGG + Intronic
998788344 5:145737576-145737598 CTGTGCTTGTTGCTGTTTTCAGG - Intronic
998835655 5:146200805-146200827 TTGTTCTTGTTGTTGTTTTTTGG + Intergenic
999598482 5:153233509-153233531 CTGTGATTATTACTGTTTTCTGG + Intergenic
1000117651 5:158168592-158168614 CTCTGCTTGGTGGTCTTTTCAGG - Intergenic
1000576425 5:162980824-162980846 CTGTGACTCTTGCTGTATTCCGG - Intergenic
1001243176 5:170085706-170085728 CCCTTCTTGATGCTGTTTTCTGG + Intergenic
1001643013 5:173258522-173258544 TTGGGTTTGTTGTTGTTTTCAGG - Intergenic
1001671027 5:173474093-173474115 TTTTGCTTTTTGCTGTGTTCTGG - Intergenic
1002557386 5:180053752-180053774 CCGTGCTTGTTGCAGTTCTCAGG - Intronic
1002895943 6:1380252-1380274 CTGGGCTTGTTTCTGTTTTATGG - Intergenic
1002971121 6:2021223-2021245 CCCAGCTTGTTGCTATTTTCTGG + Intronic
1003023397 6:2531278-2531300 CTCTGCTTTTTGCTGTATTCAGG + Intergenic
1003173928 6:3740936-3740958 CTGTGCTGGTTGCTGGTCACAGG - Intronic
1003185196 6:3824339-3824361 CTGTTGTTGTTGTTTTTTTCTGG - Intergenic
1004217325 6:13714907-13714929 CTCTGCTTGCTGGTGTATTCTGG - Intergenic
1005110895 6:22280446-22280468 ATTTGCTTCTTGCTATTTTCAGG + Intergenic
1005219593 6:23571685-23571707 GAGTGCTTGTTGCTGTCCTCTGG + Intergenic
1006064073 6:31449264-31449286 CTGTGCTGGTTGCTGTTTTGTGG - Intergenic
1007992634 6:46273067-46273089 CTGTGTTTGTTTTTGTTTTAAGG + Intronic
1009639240 6:66309077-66309099 CTATGCTTGTTAATGTTCTCAGG + Intergenic
1009923537 6:70092899-70092921 CTGAGCTTGTTCCTGTTTCACGG + Intronic
1010163192 6:72883317-72883339 TTGTTGTTGTTGTTGTTTTCTGG + Intronic
1010252540 6:73722942-73722964 CTGCCCTTGTTGCTATTTTAAGG - Intronic
1011687419 6:89834746-89834768 CAGTGCTTCCTGCTGATTTCAGG - Intronic
1012153840 6:95791226-95791248 TTGTGGTTGTTGTTGTTTTGAGG - Intergenic
1012269670 6:97193381-97193403 CAGTGCTAGTTACTGTTTTTGGG - Intronic
1012672727 6:102075862-102075884 CTGTGCTTCTTGGTATTTTCTGG + Intergenic
1012963698 6:105649649-105649671 CTTTGCTATTGGCTGTTTTCAGG - Intergenic
1013042765 6:106452466-106452488 CTTTGCTTTTTGCTGCCTTCAGG + Intergenic
1013604027 6:111731568-111731590 CTGCTGTTGTTGCTGATTTCTGG - Intronic
1014096163 6:117464428-117464450 CTGTGCCTGCTGGTGTTTGCCGG + Intronic
1014456872 6:121645788-121645810 CTGTTTTTATTGTTGTTTTCAGG + Intergenic
1014504420 6:122236279-122236301 CTCTTTTTGTTGCTTTTTTCAGG - Intergenic
1017043162 6:150324079-150324101 CTGTGATTGCTGCTCTTTTTAGG - Intergenic
1017215364 6:151900782-151900804 CTGTGCTATGGGCTGTTTTCAGG + Intronic
1017320147 6:153082124-153082146 CTGTGCATGTATCTGGTTTCTGG + Intronic
1017776726 6:157686550-157686572 CTCTGCTTCTTGCTCTTTGCTGG - Intergenic
1018586266 6:165363145-165363167 CTTTTCTTGTTTCTGATTTCAGG - Intronic
1018966831 6:168496358-168496380 CTGTGCTAGTGGCTGCTGTCTGG - Intronic
1019327872 7:447008-447030 TTGTTTTTGTTGCTGTTTTGGGG + Intergenic
1019506302 7:1393178-1393200 CTGTCCTTGCAGCTGTTTTAGGG + Intergenic
1019646391 7:2131662-2131684 CTGTCCCTGTTGCTGCTCTCTGG - Intronic
1021141203 7:17028029-17028051 CTGTGTTGGTTCCTGTGTTCAGG + Intergenic
1021271339 7:18590355-18590377 GAGTTCTTGTTGCTGTTTTATGG - Exonic
1021914695 7:25419698-25419720 TGGTTCTTGTTCCTGTTTTCCGG + Intergenic
1022603908 7:31789844-31789866 CTGTGTGTGTGGCTTTTTTCAGG + Intronic
1022797682 7:33745186-33745208 CCGTGCGTGTTTCAGTTTTCTGG - Intergenic
1023578510 7:41655838-41655860 CTTTTCGTGTTGCTGTTTTTGGG - Intergenic
1025088217 7:56040783-56040805 CTGTTTTTGCTGGTGTTTTCCGG - Intronic
1025307557 7:57877167-57877189 CTGTGCTTTTTTCTTTTTTAAGG - Intergenic
1025838126 7:65115250-65115272 CTGTGCTTTTTTCTTTTTTAAGG + Intergenic
1025879149 7:65517833-65517855 CTGTGCTTTTTTCTTTTTTAAGG - Intergenic
1025884947 7:65580723-65580745 CTGTGCTTTTTTCTTTTTTAAGG - Intergenic
1026812528 7:73480673-73480695 CTTTACATGTTGCTCTTTTCTGG - Intronic
1026951717 7:74351917-74351939 CTGGGCTTGCTCCTGTTTTCTGG - Intronic
1027138718 7:75641798-75641820 CTGTTCTTCCTCCTGTTTTCTGG + Intronic
1027824406 7:83092432-83092454 CTATGTTTGATGCTGTTATCTGG - Intronic
1028726259 7:94091173-94091195 CTGTCCATTTTGCTGTATTCAGG - Intergenic
1029857545 7:103532894-103532916 CTGTGATTATTGGTGATTTCTGG + Intronic
1031232412 7:119125195-119125217 CTGTCCTTCTTGCATTTTTCCGG + Intergenic
1031697551 7:124877403-124877425 CTCTGCTTTTTTCTGTTTTATGG - Intronic
1032605880 7:133352139-133352161 GTGTGTGTGTTGCTGTTTTGGGG + Intronic
1034310984 7:150087539-150087561 CTCTGCTTAGGGCTGTTTTCCGG + Intergenic
1034328149 7:150256852-150256874 CTGTGTATTTTGCTGTTTTGGGG - Intronic
1034654718 7:152720344-152720366 CTGTGCATGGTGCTGTGTGCCGG + Intergenic
1034765069 7:153712608-153712630 CTGTGTATTTTGCTGTTTTGGGG + Intergenic
1034804096 7:154073229-154073251 CTGGGATTGTGGCTGCTTTCAGG + Intronic
1034936091 7:155201928-155201950 CAGTGCTTTTTGTTCTTTTCAGG - Intergenic
1035321974 7:158036014-158036036 CTGTGCTCTCTGCTGCTTTCTGG - Intronic
1035419392 7:158714185-158714207 CTGTGCTTGTTTTTATTTCCTGG - Intergenic
1035999788 8:4588821-4588843 CTGTGCTTGATTCTGTTCACAGG + Intronic
1036837384 8:12085058-12085080 CTTTTCTTGTTCCTGTTTTTAGG - Intergenic
1036859177 8:12331302-12331324 CTTTTCTTGTTCCTGTTTTTAGG - Intergenic
1036925671 8:12902671-12902693 CTGTGATAGTTTCTGTTATCAGG + Intergenic
1037793422 8:21968741-21968763 CTGAGCCTGTTCCTGTTTTATGG + Intronic
1038095068 8:24299806-24299828 CTGAGGTTGTTGCTCTCTTCTGG + Intronic
1038164822 8:25075311-25075333 CTGTGATTGTTTCTGTCTCCAGG + Intergenic
1039041870 8:33416087-33416109 CTTTGATTGTTTTTGTTTTCTGG - Intronic
1039092134 8:33843607-33843629 CTGAGCTTGTCGCTGTTTCTGGG + Intergenic
1039139395 8:34368618-34368640 CTGTGCCTTTTGATGTTTCCTGG + Intergenic
1040518394 8:48153437-48153459 CTGTGCTCATTGCTGTTTCCAGG - Intergenic
1041193627 8:55378110-55378132 CTGGTCTTGTTGTTATTTTCTGG + Intronic
1044136356 8:88591156-88591178 TTGTTGTTGTTGCTGTTTTTTGG + Intergenic
1044542811 8:93426765-93426787 CTTTGCTTGTTGCTTTTTAAGGG - Intergenic
1045062685 8:98423049-98423071 CTGTGCTTGGAGCTGTGGTCTGG - Intronic
1046731387 8:117730106-117730128 CTGTCCTTGCTGTTGTTTACTGG + Intergenic
1047200513 8:122761300-122761322 CTGTGCCTGTTAGTGTTTGCAGG - Intergenic
1047834376 8:128672312-128672334 CTCTGCTTTTAGCTGTATTCTGG + Intergenic
1048586113 8:135775808-135775830 CAGTGCTGGATGCTGTGTTCAGG - Intergenic
1049237688 8:141520314-141520336 CACTGTTAGTTGCTGTTTTCAGG - Intergenic
1049430104 8:142558544-142558566 CTGTACTTGTTTGTGTTTTAAGG - Intergenic
1050176722 9:2876361-2876383 ATGTGCTTGGTGCAGTGTTCTGG + Intergenic
1050317310 9:4415733-4415755 TTGTTTTTGTTTCTGTTTTCTGG - Intergenic
1050844344 9:10195432-10195454 CTGTCCATGTGACTGTTTTCTGG + Intronic
1050994715 9:12201878-12201900 CTATGCATGTTGCTGTCTTGTGG + Intergenic
1051119649 9:13737879-13737901 TTGTGCTTTTTGCTTTCTTCTGG + Intergenic
1052058090 9:23925273-23925295 CTGTGCTAGTTGCTTTTAACTGG + Intergenic
1052178662 9:25498184-25498206 TTGTTTTTGTTGCTGTTTTCGGG - Intergenic
1053033708 9:34806431-34806453 CTGTTGTTGTTGTTGTTTTGGGG + Intergenic
1053698231 9:40659500-40659522 CTGTGCTTTTTTCTTTTTTAAGG - Intergenic
1053721495 9:40951329-40951351 CTGTTTTTGTTTTTGTTTTCTGG + Intergenic
1053944237 9:43289711-43289733 CTGTGCTTTTTTCTTTTTTAAGG - Intergenic
1054309522 9:63458908-63458930 CTGTGCTTTTTTCTTTTTTAAGG - Intergenic
1054344500 9:63900840-63900862 CTGTTTTTGTTTTTGTTTTCTGG - Intergenic
1054408313 9:64783044-64783066 CTGTGCTTTTTTCTTTTTTAAGG - Intergenic
1054441462 9:65266857-65266879 CTGTGCTTTTTTCTTTTTTAAGG - Intergenic
1054488816 9:65754632-65754654 CTGTGCTTTTTTCTTTTTTAAGG + Intergenic
1055093314 9:72384779-72384801 CTTTTCTTTTTTCTGTTTTCTGG - Intergenic
1056127091 9:83544805-83544827 CTTTGCTTCTTGGTGCTTTCAGG - Intergenic
1057535632 9:95901537-95901559 TTTTGCTTGTTGTTGTTTTTAGG + Intronic
1060778412 9:126393507-126393529 CTGGGCTTGTCACTGTTTTCTGG + Intronic
1062033704 9:134373366-134373388 CTGTGCCTGCTGCTGTGTGCCGG + Intronic
1062131808 9:134899674-134899696 CTGTGCCTTTTGGTATTTTCAGG - Intergenic
1202780594 9_KI270717v1_random:32691-32713 CTGTGCTTTTTTCTTTTTTAAGG - Intergenic
1203453695 Un_GL000219v1:144817-144839 CTGTTTTTGTTTTTGTTTTCTGG - Intergenic
1203581931 Un_KI270746v1:15305-15327 CTGTGCTTTTTTCTTTTTTAAGG + Intergenic
1203587373 Un_KI270747v1:18289-18311 CTGTGCTTTTTTCTTTTTTAAGG - Intergenic
1203615957 Un_KI270749v1:64410-64432 CTGTGCTTTTTTCTTTTTTAAGG + Intergenic
1186154950 X:6715810-6715832 CTGTGCTTCTTGCAGTTCTGAGG - Intergenic
1186185341 X:7014982-7015004 CTGGTCTTGTTTCTGTTCTCTGG + Intergenic
1187109337 X:16279989-16280011 CAGTACTTGTTCCTGTTGTCTGG + Intergenic
1187488380 X:19725944-19725966 CTGTGCTGGCTACTGGTTTCTGG - Intronic
1187663466 X:21575711-21575733 CGGTGCCTATTGATGTTTTCAGG - Intronic
1188101300 X:26091299-26091321 CTCTTGTTGTTGCTGTTTTGTGG + Intergenic
1188143284 X:26578751-26578773 CTGTTATTTTTACTGTTTTCAGG - Intergenic
1190914407 X:54799782-54799804 CTCTGATTGTTCCTGTTTTATGG - Intergenic
1191077922 X:56475598-56475620 CTATACTTATTGGTGTTTTCAGG + Intergenic
1193292836 X:79796721-79796743 CTGTGCTTGTTGCTGCCTGTGGG - Intergenic
1193317979 X:80086184-80086206 CTATGCTTGTTGCTGCTTTTAGG + Intergenic
1193662387 X:84273289-84273311 CTTGTCTTGTTGCAGTTTTCAGG - Intergenic
1193666964 X:84332113-84332135 CAGTTCTTGTTACTGATTTCAGG - Intronic
1193844585 X:86453281-86453303 CTGTATATTTTGCTGTTTTCGGG + Intronic
1193970961 X:88052572-88052594 CTGTGTTTTTTGCTGTTTTGGGG - Intergenic
1196972462 X:121124474-121124496 CTGTGTTTGTTGATGTTTCCAGG + Intergenic
1197202946 X:123764658-123764680 CTGTGGTTATTGCTCTTTTCAGG + Intergenic
1197417464 X:126192242-126192264 TTTTGTTTGTTGCTGTTTTTTGG + Intergenic
1199823842 X:151477865-151477887 ATGTTGTTGGTGCTGTTTTCTGG - Intergenic
1199985091 X:152944670-152944692 CTGTCCTTCTTGCTGGATTCAGG + Intronic
1201408321 Y:13672239-13672261 CTATCCTTGCTGCTGTTTTCTGG + Intergenic
1201525256 Y:14925950-14925972 CTGTGGTTGTTGTTTTATTCAGG + Intergenic
1201782744 Y:17741416-17741438 CTGTCCTTGTGTCTATTTTCTGG + Intergenic
1201818809 Y:18164572-18164594 CTGTCCTTGTGTCTATTTTCTGG - Intergenic
1202014650 Y:20388058-20388080 TTGTTGTTGTTGCTGTTTTGGGG - Intergenic