ID: 998788871

View in Genome Browser
Species Human (GRCh38)
Location 5:145744236-145744258
Sequence CTGCTGGTCTGCAGGAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 326}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998788871_998788878 30 Left 998788871 5:145744236-145744258 CCTTTTCTCCTGCAGACCAGCAG 0: 1
1: 0
2: 3
3: 34
4: 326
Right 998788878 5:145744289-145744311 GAATCTGGGCAGACCAGACGAGG 0: 1
1: 0
2: 3
3: 14
4: 133
998788871_998788876 15 Left 998788871 5:145744236-145744258 CCTTTTCTCCTGCAGACCAGCAG 0: 1
1: 0
2: 3
3: 34
4: 326
Right 998788876 5:145744274-145744296 AGACTTAGTTCTGAGGAATCTGG 0: 1
1: 0
2: 0
3: 10
4: 121
998788871_998788877 16 Left 998788871 5:145744236-145744258 CCTTTTCTCCTGCAGACCAGCAG 0: 1
1: 0
2: 3
3: 34
4: 326
Right 998788877 5:145744275-145744297 GACTTAGTTCTGAGGAATCTGGG No data
998788871_998788874 8 Left 998788871 5:145744236-145744258 CCTTTTCTCCTGCAGACCAGCAG 0: 1
1: 0
2: 3
3: 34
4: 326
Right 998788874 5:145744267-145744289 TTTCCTCAGACTTAGTTCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998788871 Original CRISPR CTGCTGGTCTGCAGGAGAAA AGG (reversed) Intronic
900114922 1:1024336-1024358 CTCCTGCTCTGTAGGAGATAAGG + Intronic
900630224 1:3631182-3631204 GTGCTGGCCTGCAGGACAAGGGG - Intronic
900762679 1:4483470-4483492 CTGCTGGTCTCCAGGCCCAAGGG - Intergenic
900810313 1:4796840-4796862 CTGCTGTACTGCAGGAGGGAAGG + Intergenic
901822472 1:11838825-11838847 CTGCTGGCAGGCAGGGGAAAGGG - Intronic
902104949 1:14027161-14027183 CTGTTTGTCTGCAGGTGAACTGG - Intergenic
902793697 1:18786314-18786336 TTGCTGGGTTGCAGAAGAAATGG + Intergenic
902814932 1:18910868-18910890 TTGCTATTATGCAGGAGAAAGGG - Intronic
903620733 1:24696172-24696194 TTCCTGGGCTGCTGGAGAAAAGG + Intergenic
905688590 1:39926511-39926533 CTGCTGATGTGGAGGAGAGATGG - Intergenic
905721988 1:40211820-40211842 CAGCTGGTCACCAGTAGAAACGG - Intronic
907661460 1:56396593-56396615 CTGTTGGTGTGTAGGAGAGAAGG - Intergenic
907949659 1:59170055-59170077 CTGGTGGTATGCAGGAGAGGTGG - Intergenic
908601564 1:65745095-65745117 CTTCAGGTGTGCAGAAGAAAAGG + Intergenic
908763981 1:67537911-67537933 CTCCTGGCCTGCAGGAGAGCAGG + Intergenic
909528762 1:76658005-76658027 CTGGCGAACTGCAGGAGAAAGGG + Intergenic
909548912 1:76876884-76876906 CTGCTGGGCTGAGGGAGAGAAGG + Intronic
911045932 1:93628352-93628374 CTGCTAGACTGCAGGGGACAGGG - Intronic
911190630 1:94945071-94945093 CTCCAGGCCTGCTGGAGAAACGG - Intergenic
912498414 1:110106192-110106214 CTGGTGATCTGCAGGAGGAGGGG + Intergenic
913324543 1:117615327-117615349 CTGCTGGTGAGTAGCAGAAATGG - Intronic
913426891 1:118741917-118741939 CAGCTGGTATCCAGGGGAAATGG - Intergenic
913537021 1:119782914-119782936 CTGCAGGGCTGCAGGGGAAGGGG - Intergenic
914345278 1:146793792-146793814 CTGCTGTTCTGCAGGATCAAGGG - Intergenic
914385691 1:147167825-147167847 CCGCTGGTCTGAAGGAGGCAAGG - Exonic
915149236 1:153816614-153816636 ATCATGGTATGCAGGAGAAAGGG + Intronic
915205883 1:154270185-154270207 CTGCCCGTCTGCAGGGGAATGGG - Exonic
916712875 1:167427498-167427520 CTCCTGGAGTGCAGGAGGAAGGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
919504077 1:198375612-198375634 GTGCTGGTCTTCAGAAGTAAGGG + Intergenic
919849435 1:201662707-201662729 CTGCAGGCCTGCAGGAGAAGTGG - Intronic
920342079 1:205281623-205281645 CTCCTGCTTTTCAGGAGAAAGGG + Intergenic
921099063 1:211912558-211912580 CATCTGGTCTGCAGGAGAACAGG + Intergenic
924389827 1:243541837-243541859 TTGCAAGCCTGCAGGAGAAAAGG + Intronic
1062795139 10:339153-339175 CTGCTGAACTGCATGGGAAAGGG + Intronic
1063514749 10:6684768-6684790 CATCTGTTCTGCAGCAGAAAGGG - Intergenic
1063654264 10:7971743-7971765 CTGCTGGTGTCCTGGAAAAATGG + Intronic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1065668304 10:28086661-28086683 CTACTGGTCAGCAGTTGAAACGG - Intronic
1067763648 10:49069462-49069484 GTGCTGGGCTGCAGGAGATGGGG - Intronic
1069681905 10:70291525-70291547 CTGCTGCTGTGCAAGAGAAAGGG - Intergenic
1069821101 10:71229284-71229306 CAGCTGGTCTGCTGGAAAAGAGG + Intronic
1070350109 10:75583663-75583685 CTGATGGTGGGCAGGAGGAAAGG - Intronic
1070658665 10:78289282-78289304 CTGCTCTTCTCCAGGTGAAATGG + Intergenic
1071093115 10:81943540-81943562 CTGCTGGTATGCAATGGAAATGG - Intronic
1071949299 10:90684612-90684634 CTGCTGTTATGCAGTACAAAGGG - Intergenic
1073070523 10:100790609-100790631 CTGCTTGTCTGCAGAGGAAGAGG - Intronic
1073340122 10:102737996-102738018 CTTCTGGTCTCCAGGGGACAGGG - Exonic
1073553339 10:104424406-104424428 CTGGAGGTGTGCAGGACAAAAGG - Intronic
1076039740 10:127235729-127235751 TTGCTGGTCTGAAGGCAAAATGG - Intronic
1076374467 10:129973817-129973839 CTGCTGCTCTGGAAAAGAAAAGG + Intergenic
1076454025 10:130576849-130576871 CTGATGGTCACCAAGAGAAAAGG - Intergenic
1076931015 10:133531760-133531782 CCGCTGGTCTGCAAGAGGACTGG - Intronic
1077340185 11:2022971-2022993 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1077378523 11:2216645-2216667 CTGGTGCCCTCCAGGAGAAAGGG - Intergenic
1078450252 11:11435786-11435808 CTGCTGGTCGGCGGGAGGACCGG - Intronic
1079182731 11:18208257-18208279 CTGCTGGGCTGTGGGAGAGAGGG - Intronic
1081633161 11:44702955-44702977 CTGCTAATCTCCAAGAGAAATGG + Intergenic
1081890931 11:46542085-46542107 CTGCTAGTCCGCAGGAGGAGAGG - Exonic
1084116068 11:67043623-67043645 CTCTGGATCTGCAGGAGAAAAGG - Exonic
1084288253 11:68145737-68145759 CTTCTCGTCTGGAGGAGAGATGG + Intergenic
1084408328 11:68991680-68991702 ATGCCGTTCTGCAGGAGAGACGG + Intergenic
1084634449 11:70381533-70381555 CTGCTCCTCCCCAGGAGAAAAGG + Intronic
1087920574 11:103862250-103862272 CTGCTGGTCTGCAGAATCCAAGG - Intergenic
1089283824 11:117392989-117393011 CTGCTGAGCTGCAGGGGAGATGG - Exonic
1089290775 11:117436972-117436994 ATGCTGGCCTGCAGGTGAAGGGG - Intronic
1089352784 11:117830890-117830912 CTGCTGGGCTGGAGAAGGAAGGG - Intronic
1089641153 11:119848038-119848060 CAGCTGGTGAGCAGGAGAAGGGG - Intergenic
1090603239 11:128394329-128394351 CAGCTGGCCTGCAGCAGAAACGG + Intergenic
1202823170 11_KI270721v1_random:78160-78182 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1091760599 12:3084839-3084861 CCGCAGGTCTGCATTAGAAAAGG - Intronic
1091770324 12:3147232-3147254 CTGCTGGGCAGCAGGAGGCAGGG + Intronic
1091987757 12:4926567-4926589 CTTCTGGTGTGCATTAGAAAGGG - Intronic
1092217647 12:6694264-6694286 CTGCTGCACTACATGAGAAAGGG - Exonic
1093286086 12:17265749-17265771 CTGTAGGTCTGCAGGAGCCAGGG + Intergenic
1093286559 12:17270784-17270806 CTGGTGGTGTGGAAGAGAAATGG - Intergenic
1096510108 12:52123036-52123058 CTGCTGGTCAGCAGAAGCAGCGG - Intergenic
1096580600 12:52582353-52582375 CAGCTGGTTTGCAGGAGAGGAGG + Intergenic
1097957463 12:65500952-65500974 CTGGTGGTCAGGAGGAGGAAAGG - Intergenic
1098002370 12:65958992-65959014 CAGCAGGTCTGCAGTAGAAGAGG - Intronic
1098360154 12:69646635-69646657 CTGATGCTCTGCAGGGAAAAAGG - Intronic
1098435709 12:70466434-70466456 CTCCTAGTCTGCAAGAGAAAGGG + Intergenic
1099951614 12:89310243-89310265 CTGCTGGTGGGCAGGATAGAAGG + Intergenic
1101772259 12:107761802-107761824 CTGCTGTTCTGCTGGTGTAAGGG - Intergenic
1101822809 12:108196964-108196986 CAGCTGGTCAGCAGCAGGAACGG + Intronic
1101884478 12:108649950-108649972 CTGCAGGTTTCCAGGAGAAATGG - Intronic
1102562114 12:113769639-113769661 TGGGTGGTCTGCATGAGAAATGG - Intergenic
1104076106 12:125391553-125391575 CTGCAGGTCTGCAGGGGAGTAGG - Intronic
1105774070 13:23640093-23640115 GTGCTGACCTGCAAGAGAAAGGG + Intronic
1105869556 13:24492125-24492147 CGGATCCTCTGCAGGAGAAAGGG - Intronic
1106169837 13:27279666-27279688 CTGCTGGCCTGCCGGAGAGCAGG - Intergenic
1107223210 13:38012094-38012116 CTGCTGATTTGAAAGAGAAAAGG + Intergenic
1107905093 13:45054311-45054333 CTGCTGGACTTAAGGAGCAAAGG + Intergenic
1108065850 13:46577029-46577051 CTGCTGGCCTGAAAGAAAAAAGG - Intronic
1108069304 13:46611355-46611377 CTGCTGTTCTCCAGAAGAAGTGG - Intronic
1108243877 13:48496147-48496169 CTGCCGGCCTCCTGGAGAAATGG - Intronic
1111079587 13:83285701-83285723 GTGATGGTCTGCAGGGGGAAAGG + Intergenic
1111694216 13:91603200-91603222 CAGGTGGTCTGGATGAGAAACGG - Intronic
1111778642 13:92694102-92694124 CTGCAGGTATGCAGAAGACAAGG + Intronic
1113282247 13:108801348-108801370 CTGCTGGACTGTAGGTGAATTGG + Intronic
1113452857 13:110424131-110424153 CTGCTGGTGGGCATGTGAAATGG - Intronic
1113588917 13:111484524-111484546 CTGCTGAGCTGCTGGAGACAAGG - Intergenic
1113916302 13:113876009-113876031 CTTCAGGGCTGCAGAAGAAAAGG + Intergenic
1117284470 14:54273479-54273501 CTGCTGTCTGGCAGGAGAAATGG - Intergenic
1117288122 14:54307131-54307153 ACTCTGGTCTGCAGGAGGAAAGG + Intergenic
1117438698 14:55741184-55741206 CCACTGGTCTACAGGAGTAAAGG + Intergenic
1119516046 14:75249220-75249242 CAGCTGGTATGCAGGAGAAAAGG + Intronic
1119678974 14:76577707-76577729 CTTCTGGTCTGAAGGACAAATGG - Intergenic
1121116814 14:91349455-91349477 CTGCTGTTCAGAGGGAGAAACGG + Intronic
1122879130 14:104682166-104682188 CTGCTATTCTACAGGAGAAAGGG + Intergenic
1123702223 15:22923508-22923530 CTGCTGGTAAGAAGGAGAAATGG + Intronic
1124508348 15:30298761-30298783 CTGCTGGTGTGAATGAAAAATGG - Intergenic
1124724075 15:32139461-32139483 CTGCTGGTGGGCATGAGAAATGG - Intronic
1124735209 15:32239895-32239917 CTGCTGGTGTGAATGAAAAATGG + Intergenic
1125236200 15:37516600-37516622 CTAATGGTTTGTAGGAGAAATGG - Intergenic
1125893436 15:43282519-43282541 CTGCTGGTCTGCTGGGGAGTGGG + Exonic
1126432552 15:48601672-48601694 CTACTTGACTTCAGGAGAAAGGG + Intronic
1127862812 15:63008600-63008622 CTCCTGGGCTGAAGGATAAAAGG + Intergenic
1128636896 15:69308352-69308374 TTGAATGTCTGCAGGAGAAATGG + Intronic
1128887974 15:71305711-71305733 CTGATGCTGTCCAGGAGAAATGG + Intronic
1129536295 15:76315970-76315992 CAGCTGGTCTTCTGGAGGAATGG + Intergenic
1129670591 15:77605754-77605776 CAGCTGCCCTGCAGGAGAAAGGG + Intergenic
1129996005 15:80006821-80006843 CTGCTGTGCTCCAGGACAAATGG - Intergenic
1130757761 15:86783957-86783979 CTGCTGGTTTAGAGGAGGAATGG + Intronic
1131633047 15:94199961-94199983 CTGCTGGTTGGCAGAAGAAAAGG - Intergenic
1132937366 16:2487975-2487997 CTGCTTGTCTGCTGGAGCGAAGG + Intronic
1133012837 16:2924508-2924530 CTGCTGGGCTGCAGGGTACAAGG + Intronic
1133166968 16:3954676-3954698 TTGCTGCTTTGCAGGAGTAAGGG + Intronic
1134078519 16:11308913-11308935 CTGCAGGTGTGCTGGAGACAGGG + Intronic
1136703560 16:32165802-32165824 GTGATGGTCTGCAGGGGAACCGG + Intergenic
1136764142 16:32761800-32761822 GTGATGGTCTGCAGGGGAACCGG - Intergenic
1136803956 16:33108586-33108608 GTGATGGTCTGCAGGGGAACCGG + Intergenic
1137330666 16:47492408-47492430 CTGCTGATCTGGTGGAGAAAAGG + Intronic
1137769411 16:51004067-51004089 CTGCTGGCCCACAGGAGATAGGG + Intergenic
1139267743 16:65656068-65656090 CACCTGCTCTGCAGGAGACAGGG + Intergenic
1139908654 16:70383087-70383109 CTGAGGTTCTGCAGGGGAAATGG + Intronic
1139988714 16:70921500-70921522 CTGCTGTTCTGCAGGATCAAGGG + Intronic
1140708400 16:77653088-77653110 ATGCTGGTCTACAGGAGAGAAGG - Intergenic
1141545655 16:84766476-84766498 CTGCTGGGCTGAAGGAGCAAAGG - Intronic
1141801195 16:86310552-86310574 CTGCTGGTCCTCAGGAGGTATGG + Intergenic
1142051816 16:87963980-87964002 TAGCTGGTCATCAGGAGAAACGG - Intronic
1203066496 16_KI270728v1_random:1023922-1023944 GTGATGGTCTGCAGGGGAACCGG - Intergenic
1142673625 17:1499702-1499724 CTGCTGGTCTCCAGGAGGGCAGG - Intronic
1142698052 17:1644304-1644326 CTGCTGGGCTGGAGGAGAGCTGG + Intronic
1142929831 17:3274285-3274307 CTGTTTGTCTGTAGAAGAAATGG - Intergenic
1144862887 17:18316671-18316693 AGGCTGGTCTGCAGGTGTAAAGG - Exonic
1145980657 17:29009438-29009460 CTGCTGGGAAGTAGGAGAAAGGG + Intronic
1147234563 17:39047715-39047737 CTGCTGCCCTCCAGAAGAAAGGG + Intergenic
1147872764 17:43599142-43599164 CTGCTGCTCTGCGTAAGAAAAGG + Intergenic
1148044449 17:44734174-44734196 CTGCTGAACTGAAGGACAAATGG + Intronic
1149974937 17:61256093-61256115 CTACTGGTAATCAGGAGAAATGG + Intronic
1151537287 17:74746056-74746078 GTGCTTGTGTGCTGGAGAAAAGG - Exonic
1151694306 17:75706262-75706284 CCGCTGGCCTGCAGGGGGAAGGG + Intronic
1151759162 17:76090823-76090845 CTGCTGGTCTGAGCGTGAAAGGG + Intronic
1152190753 17:78885891-78885913 CAGCTGGACTGCGGTAGAAAGGG - Intronic
1152193019 17:78899843-78899865 GTGCTGGGCTTCTGGAGAAAGGG - Intronic
1152465094 17:80461898-80461920 CAGCTGGTCGGCAGCAGAAGAGG - Intergenic
1152507577 17:80760724-80760746 CTGCCGGTCTGCAGGTGACCTGG + Intronic
1152539289 17:80966874-80966896 CTTCTGGCCTGCATGAGAAGTGG - Intergenic
1153733310 18:8037767-8037789 CTGCTAATCTGCAGAAGACAAGG + Intronic
1154430529 18:14304800-14304822 ATGCTGGTGGGCAGTAGAAAGGG + Intergenic
1155163230 18:23212219-23212241 CAGCTGGTCTGCAGTAAAGATGG + Intronic
1156934967 18:42692733-42692755 CTGCTGGTCAGCATGTAAAAGGG - Intergenic
1157922554 18:51728218-51728240 CTGCTGGTCTGGAAGAGAGAAGG + Intergenic
1161528214 19:4770532-4770554 CTGCTTCTCTCCAGGAGAACCGG + Intergenic
1162938383 19:13993547-13993569 CTGCTGGGGTGCAGGCGAAGGGG + Exonic
1162995293 19:14330998-14331020 CTGCTGGTTTGCATGTGAAATGG + Intergenic
1163328899 19:16623421-16623443 CTGCTTTTCTGCAGAATAAATGG + Intronic
1163581786 19:18143833-18143855 CTGATGGTATTCAGGAGAGATGG - Exonic
1166597948 19:44067454-44067476 CTGCTGTTCTGCAGCACTAAAGG - Exonic
1166948260 19:46410444-46410466 CTGCTGGTTTGGAGGGGACAGGG - Exonic
1168104944 19:54160869-54160891 CTGCTGATCTCCAGGTGAGACGG - Exonic
925432380 2:3806377-3806399 CTTCTGTTCTGCAGCAGAGAGGG + Intronic
925622294 2:5805800-5805822 CTGATGGTCAGCAGGAGATGAGG - Intergenic
925659983 2:6191888-6191910 CTGCTGTTGTGCAGAAGAAGTGG + Intergenic
926521079 2:13914683-13914705 CTGCTGGTCTGAATGTAAAATGG + Intergenic
927051313 2:19332067-19332089 CTGATGAACTGCAGAAGAAATGG - Intergenic
929405562 2:41637421-41637443 CTGCTGGTCTGCAGAGACAATGG - Intergenic
930809820 2:55528790-55528812 CTACTGTTTTGCAGTAGAAATGG + Intronic
931116938 2:59175091-59175113 CTGCGGGTCTGGAGGAGCAGCGG - Intergenic
931121831 2:59228271-59228293 TTTCTTGTCTGCAGGAGTAACGG + Intergenic
932716892 2:74107219-74107241 CTGCAGCTCTGCAGGAGGAAGGG - Exonic
932805340 2:74778287-74778309 CTGGTGGTTTGCAGTTGAAAGGG + Intergenic
934098952 2:88633458-88633480 TTGCTGGTCTGAAGGTAAAATGG + Intergenic
934649904 2:96084819-96084841 CTGCTGGGCTGGAGGAGGCAAGG + Intergenic
935427134 2:102931936-102931958 CTGAAAGGCTGCAGGAGAAATGG - Intergenic
935727105 2:106032955-106032977 CTGCTGGTGGGAAAGAGAAATGG + Intergenic
936733126 2:115407531-115407553 CTGCTGGCCTGAAGGAGAGAAGG + Intronic
936856374 2:116962709-116962731 TTCCTGTTCTGCTGGAGAAAGGG + Intergenic
937034157 2:118766783-118766805 AGGCAGGTCTGCAGGTGAAAAGG + Intergenic
937129222 2:119494677-119494699 CTCCTGGTCTGCAGGAAAGGTGG + Intronic
937679406 2:124627412-124627434 CTGGTGATATCCAGGAGAAAAGG + Intronic
937794591 2:126001889-126001911 CTGCTGGTGTGAAGGCCAAAGGG - Intergenic
937815248 2:126243999-126244021 CTCTTGGTCTGAAGGAGAATGGG - Intergenic
938415447 2:131100259-131100281 CAGGTGGGCTGGAGGAGAAAGGG + Intergenic
938792749 2:134691245-134691267 CTGCTGGCCTTCTGCAGAAAAGG + Intronic
942183197 2:173400405-173400427 CTTCTGATCTGCAGGAGAATCGG - Intergenic
944686594 2:202123067-202123089 CTCCTGGGCTGTAGGGGAAATGG + Intronic
946475462 2:220002396-220002418 CTGCTCCTATGCAGGAGAGAGGG + Intergenic
947770417 2:232666052-232666074 CTGGAGGTCTGCAGCAGAACTGG + Intronic
947983502 2:234429269-234429291 CTGCTGACTTGGAGGAGAAAGGG - Intergenic
948409855 2:237750644-237750666 CTGCTGCTCTGCTGTAGAAACGG - Intronic
948570753 2:238915730-238915752 CTGATGATCTGCAAGAGACACGG + Intergenic
948723176 2:239914063-239914085 CTGCTGGTCTGGGGAAGTAAAGG - Intronic
1170132941 20:13042446-13042468 CTGCTAGTGTGCTGGAGTAAGGG + Intronic
1170954286 20:20964196-20964218 CTGCTTGTCTGTAGGGGGAAAGG + Intergenic
1173464687 20:43271582-43271604 CTGCTGTCCTGCAGAAGGAAGGG + Intergenic
1173742757 20:45413004-45413026 CTGTGGTTCGGCAGGAGAAAAGG - Intergenic
1174767206 20:53265487-53265509 CTGCGGGGCTGGAGGAGGAAAGG - Intronic
1178003674 21:28192772-28192794 CTGCTTGTCTGCTGGTGATATGG - Intergenic
1178065884 21:28903832-28903854 CTCATGGTCTGCAGGTAAAAAGG - Intergenic
1178698058 21:34810973-34810995 CTGCTGCTCTGCAGGAGGAAGGG - Intronic
1179943978 21:44658255-44658277 CAGCTGGTCAGCAGCAGGAAGGG - Exonic
1182094837 22:27619130-27619152 CTGCTGGTCTGCAGGACACAAGG + Intergenic
1183281805 22:36936260-36936282 TGGCTGGTGTGGAGGAGAAATGG + Intronic
1184050729 22:42002104-42002126 CTGCTTGTGTGTTGGAGAAAGGG + Intronic
1185343755 22:50302601-50302623 CTGAGGGACTTCAGGAGAAAAGG - Intronic
949514783 3:4797039-4797061 AGGCTGGTCTGCAGGAGGCAAGG + Intronic
949892466 3:8743587-8743609 ACTCTGGGCTGCAGGAGAAATGG - Intronic
950046117 3:9949501-9949523 CTGGTGGTCTGAGGGAGAAGTGG + Exonic
950297946 3:11848116-11848138 CTGCTGCCCTGCAGGAGCTAGGG + Intergenic
950744297 3:15074449-15074471 CTGCTGGGCTCCAGCTGAAAAGG + Exonic
954201269 3:49024745-49024767 CTGGTGCTGTGCAGGACAAAGGG - Exonic
954370893 3:50169149-50169171 CTGCTGGTCTCCAGGACATCAGG - Intronic
954598188 3:51845569-51845591 CTGCTGGTGGGGTGGAGAAAAGG + Intergenic
955701949 3:61690367-61690389 CTGCTTTTCTCCAGGATAAATGG + Intronic
955755422 3:62220595-62220617 TTGCTGGTCTGCAGCACTAAAGG - Intronic
955943630 3:64170123-64170145 ATGTGGGTCTCCAGGAGAAAAGG - Intronic
957522645 3:81339399-81339421 CTTCTGGTTCTCAGGAGAAAGGG + Intergenic
957595002 3:82252339-82252361 CTTCTCCCCTGCAGGAGAAATGG + Intergenic
962348411 3:134639403-134639425 CTGCTGGTGTGCATGATGAAGGG + Intronic
962444534 3:135452905-135452927 CCTCTGGTCAGTAGGAGAAAGGG - Intergenic
962474204 3:135741341-135741363 CTGCTGCTCTGCAGAATGAATGG - Intergenic
963047013 3:141109996-141110018 CTGTTGGCCTGAGGGAGAAATGG + Intronic
963704202 3:148665509-148665531 CTGCTGTTTTCCAAGAGAAATGG - Intergenic
964473991 3:157082473-157082495 GTGCTGTGCTGCAGGAGCAAAGG + Intergenic
964555409 3:157931742-157931764 CTACTGGTCTGCAGCATGAACGG - Intergenic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
968268613 3:197382190-197382212 CAGCTAGTTTGCAGGTGAAAGGG - Intergenic
968528732 4:1078671-1078693 CTGTTGGTGTCAAGGAGAAAGGG - Intronic
969417713 4:7071852-7071874 TTGCTGGTTTGAAGGAGGAAGGG + Intergenic
970200403 4:13599229-13599251 CTGCTGCTCAGCAGGAAGAAAGG + Exonic
970665244 4:18329303-18329325 ATGCTAGTCTGCAGGAGCAGAGG + Intergenic
972329264 4:38049404-38049426 CTGCTGGCTTGCTGGAGAAATGG - Intronic
972858914 4:43142701-43142723 TTGGAGGTCTGGAGGAGAAAGGG - Intergenic
972981592 4:44710507-44710529 CTGTTGGTTTCCAGCAGAAAAGG - Intronic
974696597 4:65383679-65383701 CTGCCAGTCTGAAGGAGTAATGG + Intronic
977953808 4:103003724-103003746 CTGCTGTGCTGCAGGAGCCAAGG - Intronic
978635821 4:110804731-110804753 CTGGAGGTCTGCTGGGGAAAGGG + Intergenic
978976860 4:114887783-114887805 CTACTGGTAAGCAGGAGAAGGGG + Intronic
978981558 4:114953061-114953083 CTGATGGTCTCTGGGAGAAATGG - Intronic
979087836 4:116436331-116436353 CTTTTGTTCTGAAGGAGAAATGG + Intergenic
979166560 4:117539850-117539872 CAGCTGCTGTGCAGGAGAAAAGG + Intergenic
979763067 4:124430954-124430976 CTGGTGGTTAGCAGGATAAATGG + Intergenic
980456071 4:133045444-133045466 CTGCTGATCTGCTGAAGATAAGG + Intergenic
980860031 4:138487871-138487893 CTGCAGGGCTGCCAGAGAAAAGG + Intergenic
981542823 4:145863290-145863312 CTGCTGGTGGGCACGTGAAATGG + Intronic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
984731185 4:183069508-183069530 CTGCTCCACTGCAGGAGACAGGG + Intergenic
984942347 4:184943867-184943889 GTGCTGGGCTGCTCGAGAAAGGG - Intergenic
985579056 5:687207-687229 CTTCTGGTCTCCAGGAGGATGGG + Intronic
986289206 5:6385312-6385334 CTGCTGGTCTTGAGCAGAGAAGG - Intergenic
987242437 5:16014370-16014392 CAGCTGGATTGCAGGAGAATAGG + Intergenic
987465040 5:18261861-18261883 CTGCTTCTCTGCATGTGAAATGG - Intergenic
988216040 5:28274259-28274281 CTCCTAGTCTGTAGGAGAACAGG + Intergenic
988276155 5:29083268-29083290 CTGTTGGTGTGCAGGGGACAAGG + Intergenic
989358579 5:40573203-40573225 CTGCTGATGTGGAGGAGAGAAGG - Intergenic
990894899 5:60688404-60688426 CTGCTGGTCTGTTGTAGAATAGG - Intronic
990937036 5:61162351-61162373 CTCCTGGTGTCCAGCAGAAACGG - Exonic
991071715 5:62490395-62490417 CAGGTAGTTTGCAGGAGAAAAGG + Intronic
992596930 5:78356647-78356669 CGGTTGGTTTGCAGGAGAGAGGG + Intergenic
995514536 5:112940904-112940926 CTGCAGGGCTGCAAGAAAAAGGG + Intergenic
997190510 5:131930129-131930151 CTGCTGGTACACAGGAGGAATGG - Intronic
997281846 5:132653931-132653953 CTGCTGGAATGCTGGAGACAGGG + Intergenic
997355311 5:133259017-133259039 CTGCTGGACTGAGGGAGCAAGGG + Intronic
998788871 5:145744236-145744258 CTGCTGGTCTGCAGGAGAAAAGG - Intronic
1000642732 5:163722057-163722079 CTGCTTGGATGCAGGAGACAAGG + Intergenic
1003311701 6:4974562-4974584 CTGCTGGTCTGGCTGAGACAGGG + Intergenic
1004802951 6:19171233-19171255 CTGCTCCTTTGCAGGAGAAAAGG + Intergenic
1006358699 6:33575586-33575608 GTGCTGGGCTCCAGGAGAAGGGG + Intronic
1007757984 6:44113201-44113223 TTCCTGGACTGCTGGAGAAATGG - Intergenic
1007872285 6:45053955-45053977 CTGATGGTCTTCAGGGGAGAAGG - Intronic
1012132890 6:95519127-95519149 CTCCTGGACTGCGGGAGTAAAGG - Intergenic
1012134171 6:95535332-95535354 CTGCTGGGGTGGAGGAGAAAAGG - Intergenic
1013372835 6:109484716-109484738 CTGCTGGTATGCAGAAGTCAGGG - Intergenic
1014750814 6:125253864-125253886 CTGATGGTCTTCAAAAGAAAAGG + Intronic
1015449879 6:133354559-133354581 CAACTGGTATGCAGCAGAAAGGG + Intronic
1016887191 6:148969662-148969684 CTCCAGGTCTGGAGGAAAAATGG - Intronic
1019266436 7:119849-119871 CTGCAGGTCCGCAGGGGACAAGG - Intergenic
1019313316 7:373274-373296 CTGCTTGGCTGCAGATGAAAGGG - Intergenic
1019498183 7:1350658-1350680 CTGCTGGTAGGCAGGGAAAAAGG - Intergenic
1019716480 7:2541684-2541706 CTGCTGGGCTGCATGAGGACCGG + Intronic
1019735863 7:2649489-2649511 CTGCTGGGCTGCAGGCCAGAAGG - Intronic
1019915013 7:4127584-4127606 CTGCAGATCTGTAGGAGAAGAGG - Intronic
1019938464 7:4271327-4271349 CTGCTGTCGGGCAGGAGAAATGG - Intergenic
1021189502 7:17603290-17603312 CTGCTCAGCTGCAGGAGAAAGGG - Intergenic
1022050859 7:26669649-26669671 TTCCTTTTCTGCAGGAGAAAGGG + Exonic
1023030290 7:36084943-36084965 CTGCTGCGCTGCCGGAGAAGGGG - Exonic
1023103631 7:36743216-36743238 CTGCTCCTCAGCAGGGGAAATGG - Intergenic
1023145725 7:37149007-37149029 GTGCTGGGCTCCAGGAGAATGGG - Intronic
1023186074 7:37534393-37534415 TTGATGGTCTTCACGAGAAAAGG - Intergenic
1023257868 7:38329755-38329777 CTATTGGTCTGCAGGAGAATGGG - Intergenic
1023623882 7:42097508-42097530 CTGCTGGTGTCCAGGGGAAGGGG - Intronic
1024464770 7:49700624-49700646 CTGTTGCTATACAGGAGAAAAGG - Intergenic
1027170232 7:75866674-75866696 CCTCTGGTCTGATGGAGAAATGG - Intronic
1028653928 7:93180979-93181001 CTGATGGACAGCAGGTGAAATGG + Intergenic
1030219472 7:107082081-107082103 GTGGTAATCTGCAGGAGAAATGG + Intronic
1031734889 7:125346305-125346327 CTCCTGAGCTGCAGAAGAAATGG - Intergenic
1031943661 7:127816001-127816023 CAGCTGGTCTGCAGGAGGGAAGG - Intronic
1032682409 7:134198714-134198736 CTCCTGGTCTGCAGGTGACGAGG + Intronic
1033110753 7:138572920-138572942 CTGTTGTTTTGTAGGAGAAAAGG - Intronic
1033226043 7:139563261-139563283 CTGCTGGGCTGAAGGGGCAATGG - Exonic
1033781796 7:144680031-144680053 TTTCTGGGCTGCAGGATAAATGG + Intronic
1034077156 7:148243204-148243226 CTCCTGGTCTCCTGGGGAAATGG + Intronic
1034958908 7:155352134-155352156 CTGCTGGTGTGCAGGGGACACGG + Intergenic
1035578726 8:726022-726044 TTGCTGTGCTGCAGGAGAAGTGG - Intronic
1035979224 8:4350703-4350725 CTTTTGGTCAGCAGGAGAAGTGG - Intronic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1036966950 8:13309680-13309702 CTTTTGGTCTGCTGCAGAAATGG + Intronic
1037502058 8:19495829-19495851 CTCCAGGCCTGCAGGAGGAAGGG + Intronic
1037809779 8:22080603-22080625 CTGCAGGCCTGCGGGAGAGAAGG - Exonic
1038875413 8:31543151-31543173 TTGCTGGTCTGAGGGAGCAACGG - Intergenic
1039078376 8:33712687-33712709 CTGCTGTTCTGAAGCAGACAGGG - Intergenic
1039301517 8:36214425-36214447 CTGCTTCTCTGCATGAGCAATGG + Intergenic
1041171068 8:55142190-55142212 CTGCTGATCTGCTGGTCAAACGG + Exonic
1041968441 8:63708599-63708621 GTGCTGTTGTACAGGAGAAAGGG + Intergenic
1042743137 8:72074551-72074573 CAGATTGTCAGCAGGAGAAAGGG - Intronic
1042875107 8:73434527-73434549 CAGCTGGTCTGCAGTAGAGCTGG - Intronic
1043340153 8:79228842-79228864 CTACTGGTCTGCAAGAAACATGG - Intergenic
1047896151 8:129368668-129368690 GTGCTACTCTCCAGGAGAAAGGG + Intergenic
1048307610 8:133295195-133295217 CTGCTGGTTCACAGGAGAATGGG + Intronic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1049543452 8:143218823-143218845 CTGCTGGGCTGGATGAGAAAGGG - Intergenic
1050394268 9:5178354-5178376 TTGCTGGTTGGCATGAGAAAGGG + Intronic
1051122040 9:13761918-13761940 CTGCTGGTCTGCTGGACCACAGG - Intergenic
1051841747 9:21405683-21405705 CTGCTGGCCTGCAACATAAAAGG + Intergenic
1052716993 9:32129030-32129052 CTGCTGGTCTGCGGAGGATAGGG - Intergenic
1053598337 9:39585755-39585777 CTGCTGATGTTCAGGATAAAGGG - Intergenic
1053856370 9:42342764-42342786 CTGCTGATGTTCAGGATAAAGGG - Intergenic
1058224541 9:102343511-102343533 TTGCTGGTCAGCATGAAAAATGG - Intergenic
1059421762 9:114196621-114196643 CTGATGCTCTGCAGGGGAAGGGG + Intronic
1061284332 9:129613590-129613612 CTGTTGGACTGCAGGAAAGAGGG + Exonic
1061373522 9:130211255-130211277 CTTCATGTGTGCAGGAGAAAGGG - Intronic
1062450977 9:136615675-136615697 CTGCCGGCCTGCAGGACCAAAGG - Intergenic
1062485658 9:136773990-136774012 CTGCTGGCTGGCAGGAGACAGGG + Intergenic
1186759298 X:12706755-12706777 CTGCTAGTCTCCAGCTGAAATGG + Intronic
1187147023 X:16646272-16646294 CTGCTGGTCAGCAGTAGAGCTGG - Intronic
1187756765 X:22536428-22536450 CAGCTCTTCTGCAGGGGAAAAGG - Intergenic
1189170352 X:38903381-38903403 CTGCTGGGAAGCAGGAGCAAAGG - Intergenic
1189712934 X:43833377-43833399 CTGCTGCTCTGCAGAGGACATGG + Intronic
1189847242 X:45149012-45149034 CGACTGGTCTGGAGGAGAGAAGG + Exonic
1190087588 X:47409287-47409309 GTGCTGTTCTGTGGGAGAAAGGG - Intronic
1190340620 X:49292639-49292661 CTGGTGGTCTGGGGGAGACACGG + Intronic
1190627071 X:52346466-52346488 CTGGTGGTCTGGGGGAGATACGG + Intergenic
1192210052 X:69122043-69122065 CTCCTGGTATGCAGGGAAAATGG + Intergenic
1192718732 X:73669688-73669710 CAAATGGTCTGGAGGAGAAAGGG - Intronic
1194131536 X:90088283-90088305 CTCCTGAACTGCTGGAGAAAAGG + Intergenic
1194206700 X:91019155-91019177 AGGCTGGGCTGCAGGTGAAATGG + Intergenic
1194212620 X:91087306-91087328 CTGCTGGTCTGAAAGACATAAGG - Intergenic
1196595557 X:117541671-117541693 ATTCTGGTCTGGAGGAGAAATGG - Intergenic
1197479625 X:126966275-126966297 CTGCTGACCTGGTGGAGAAAAGG - Intergenic
1200552448 Y:4593944-4593966 AGGCTGGGCTGCAGGTGAAATGG + Intergenic
1201054659 Y:9976471-9976493 CTCCTGTTCTGCTGGAGGAATGG - Intergenic
1202191724 Y:22252980-22253002 CTCCTGTTCTGCTGGAGGAATGG + Intergenic