ID: 998791776

View in Genome Browser
Species Human (GRCh38)
Location 5:145773577-145773599
Sequence AATTAAGCACAGATGGACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998791776_998791780 25 Left 998791776 5:145773577-145773599 CCTTAGTCCATCTGTGCTTAATT 0: 1
1: 0
2: 1
3: 9
4: 153
Right 998791780 5:145773625-145773647 AGAGTAAGGAACTGTTTTAGTGG 0: 1
1: 0
2: 0
3: 19
4: 203
998791776_998791778 11 Left 998791776 5:145773577-145773599 CCTTAGTCCATCTGTGCTTAATT 0: 1
1: 0
2: 1
3: 9
4: 153
Right 998791778 5:145773611-145773633 CTTCCTCACATTGAAGAGTAAGG 0: 1
1: 0
2: 0
3: 17
4: 212
998791776_998791781 29 Left 998791776 5:145773577-145773599 CCTTAGTCCATCTGTGCTTAATT 0: 1
1: 0
2: 1
3: 9
4: 153
Right 998791781 5:145773629-145773651 TAAGGAACTGTTTTAGTGGCTGG 0: 1
1: 0
2: 2
3: 13
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998791776 Original CRISPR AATTAAGCACAGATGGACTA AGG (reversed) Intronic
900834969 1:4995612-4995634 AATTCACCAAAAATGGACTATGG + Intergenic
902418013 1:16253737-16253759 AATTAAGGACAGAAGGATAAAGG + Intronic
903575968 1:24339989-24340011 ACTTAGGCTCAGAGGGACTAAGG - Intronic
905660289 1:39717309-39717331 AAAAAAGCACAGATGGAATTGGG - Intronic
906601859 1:47137415-47137437 ACTTAAGCACAGGTGGACAGGGG + Intronic
907764135 1:57391717-57391739 AAGAATGCACAGATGGATTAGGG - Intronic
908279451 1:62516474-62516496 AATTAAGAACTAATGGGCTAGGG - Intronic
910509001 1:87982733-87982755 AATTTAGCACACATGGTGTAAGG - Intergenic
913211063 1:116582913-116582935 AATCAGGGACAGATGGACAAAGG + Intronic
916899801 1:169208941-169208963 ATCTAAAAACAGATGGACTATGG - Intronic
917491031 1:175498660-175498682 AGTTAAGCAGAGAAGGAATATGG + Intronic
919604408 1:199663738-199663760 GATTAAGTAAAGATGTACTATGG - Intergenic
920263421 1:204705084-204705106 AGATTAGCAGAGATGGACTATGG + Intergenic
920854020 1:209649059-209649081 ATTTTAGCACAGATGGTATAGGG - Intronic
1064794028 10:18991042-18991064 AATTAATTCAAGATGGACTAAGG + Intergenic
1068498732 10:57817471-57817493 ATGTAACCACAGATGGTCTATGG + Intergenic
1069810145 10:71153291-71153313 AATAAAGCTCAGATAGATTAAGG + Intergenic
1071253512 10:83844776-83844798 AAATGAGAACAGATGGACAAGGG - Intergenic
1072547501 10:96450879-96450901 AATTAAGCAAAGATCAAATATGG - Intronic
1074710650 10:116174650-116174672 AAATTAGCACTTATGGACTAAGG - Intronic
1074768022 10:116714800-116714822 AATCAAGCACAGATGTTCCAAGG - Intronic
1076167784 10:128296159-128296181 AGTTAAGCACTGATTGACCAGGG - Intergenic
1078126053 11:8564632-8564654 AGTTAACCACAGATGGACCCTGG + Intronic
1079584903 11:22113735-22113757 AATTAAGCACAAAGGGACAAGGG + Intergenic
1081312691 11:41593035-41593057 ATAGAAGCACAAATGGACTAAGG + Intergenic
1086117918 11:83272968-83272990 AATGAAGCACAGAGGGGTTAAGG - Intronic
1086818192 11:91400227-91400249 AAGAAAGGAAAGATGGACTAAGG + Intergenic
1088529251 11:110790697-110790719 AATTAAGCATAGATGGAAGCGGG - Intergenic
1092444599 12:8542750-8542772 AATTAATAAAAGATGGACTGTGG - Intergenic
1092839171 12:12522484-12522506 ATATAAGCAGAGATGGACCAGGG - Intronic
1095316582 12:40769122-40769144 AATTCCACACAGATGCACTATGG - Intronic
1095827578 12:46546283-46546305 ACTTAAGATCAGATTGACTATGG + Intergenic
1096802392 12:54119798-54119820 AATTGACCCCAGATGGAATAGGG + Intergenic
1107324908 13:39231106-39231128 AATTCAGCAAACTTGGACTAGGG + Intergenic
1109229282 13:59736994-59737016 AATTAACACGAGATGGACTAAGG + Intronic
1110728774 13:78856060-78856082 AATTAATCCAAGATGGATTAAGG - Intergenic
1112149489 13:96741872-96741894 AATTCAGCACAGACTGAATACGG + Intronic
1114376672 14:22153746-22153768 AAATAAGCACATATGGAGAATGG - Intergenic
1114536497 14:23426324-23426346 AATTAAGCCCAGAGGGGTTATGG + Intronic
1114810158 14:25889616-25889638 AATTATGCACACATAGACAAAGG + Intergenic
1121656423 14:95599677-95599699 CTTTAAGCAAAGATAGACTAGGG - Intergenic
1125072154 15:35567826-35567848 AATATAACACAGATGGAATACGG - Intergenic
1125438530 15:39674680-39674702 AATTAACTCCAGATGGATTAAGG + Intronic
1125743223 15:41982012-41982034 AATTTAGTACAGCTGGGCTAAGG + Exonic
1127265931 15:57361650-57361672 AATAAAACACAAATGAACTATGG - Intergenic
1127400283 15:58578569-58578591 AATAAATCTCAGATGGATTAAGG - Intergenic
1127815315 15:62603508-62603530 AATTCAGCACAGGTTGAATAAGG - Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135390063 16:22085015-22085037 ACTGAAGCAAAGATGGACTTGGG - Intronic
1139732125 16:68955100-68955122 ACTAAAGCACAGAGTGACTATGG + Intronic
1142524289 17:528063-528085 AATTAATCCCAGATGGATTATGG - Intronic
1146134387 17:30305716-30305738 AACTGAGCACAGCTGAACTAAGG + Intergenic
1149934842 17:60794552-60794574 AATCAACCCAAGATGGACTAAGG - Intronic
1152493914 17:80657151-80657173 AAAAAAGAACAGATTGACTAGGG + Intronic
1155425188 18:25699665-25699687 AATTAAGGAGGGATGGACAAAGG - Intergenic
1155666659 18:28317446-28317468 AATAAAGCACAAGTGGAATAAGG + Intergenic
1155722069 18:29027798-29027820 AATGAGGCACAGATGTACTGAGG + Intergenic
1159406943 18:68015903-68015925 GATGAAGCACAGCTGGACTTAGG + Intergenic
1160468384 18:79103200-79103222 CATTAAGCAGATATGGACTGTGG + Intronic
1163181112 19:15603177-15603199 AATTAACCCAAGATGGATTAAGG - Intergenic
1163261914 19:16196123-16196145 AATGAGACACAGATGAACTAGGG + Intergenic
1166413147 19:42570374-42570396 AATTAAACACATATGGACTTTGG - Intergenic
924982888 2:239238-239260 AATTAAGCACGAATGTCCTAAGG + Intronic
929500297 2:42485323-42485345 ACTTAAGCTGAGATTGACTAAGG + Intronic
938766033 2:134460961-134460983 GATCAAGCACACAGGGACTAGGG + Intronic
940324532 2:152411426-152411448 ATATAAGCAAAGATGGCCTATGG - Intronic
940412285 2:153379323-153379345 AAATAAGCACAGTAGTACTAGGG - Intergenic
942552796 2:177137285-177137307 AAGTGAGCACAGATTGAGTAAGG + Intergenic
945480786 2:210343068-210343090 AATCAACCAAAGATGGATTAAGG - Intergenic
946542997 2:220706375-220706397 AATTAATTACAGATGGTATATGG + Intergenic
947351712 2:229253163-229253185 AATGAAGCTCAGACAGACTAAGG + Intronic
947897503 2:233689225-233689247 AATCACTCACAGATGGAATAGGG - Intronic
1171218268 20:23369527-23369549 AATTAAGCACAGTAGGCCAAAGG + Intronic
1174396050 20:50247480-50247502 ACTGAAGCACAGAGGGTCTAAGG + Intergenic
1177676232 21:24304502-24304524 ATAGTAGCACAGATGGACTAAGG - Intergenic
1177926630 21:27224139-27224161 AAATAAGCACAGATGTAACAAGG + Intergenic
1179310053 21:40187188-40187210 AATTACGCTCAGGTGGACCATGG - Exonic
1179343808 21:40537527-40537549 AAATAAGGACAGAGGTACTAGGG - Intronic
951850919 3:27138895-27138917 AATGAAGAACACAAGGACTATGG + Intronic
952588112 3:34917956-34917978 AATTTACCACTGAAGGACTAAGG - Intergenic
953811800 3:46118733-46118755 AATTAATCCCAGATTGATTATGG - Intergenic
954717936 3:52535944-52535966 ATTGAGGCACAGATGGGCTAAGG + Intronic
955643971 3:61116451-61116473 AATTAATCAGAAATGGACTAGGG + Intronic
957357948 3:79116165-79116187 AATTAAGCACCTATGGATTTTGG - Intronic
957650590 3:82997712-82997734 AATTAGGCACATATACACTATGG + Intergenic
958027703 3:88068202-88068224 AAATAAGCACTGATGAACAAAGG - Intronic
958132570 3:89447541-89447563 ATTTAATCACAGATGCACTTGGG - Intronic
958831292 3:99093502-99093524 AATTAATGACAGATTAACTAAGG + Intergenic
960214637 3:115016461-115016483 AATTAACCCAAGATGGATTAAGG - Intronic
962634888 3:137320334-137320356 AATTGAACCCAGATGGACTGTGG + Intergenic
964559210 3:157975106-157975128 AATTGACTACAGATGAACTATGG + Intergenic
970305132 4:14723678-14723700 AATTAATTAAAGATGGATTAAGG + Intergenic
971010026 4:22423774-22423796 TATTAGGCTCAGATGGACTATGG + Intronic
973709230 4:53611545-53611567 AAATAAGTAGAGATGGAGTAAGG + Intronic
974251105 4:59384463-59384485 AATTAAGCACTGAAGGATTCAGG - Intergenic
979921151 4:126498224-126498246 AATTAACTAAAGATGGATTAGGG + Intergenic
979998136 4:127457977-127457999 AATTAAGTAAAGATGGTCTCTGG + Intergenic
980237651 4:130130235-130130257 AATAAAGCATAGATTGACAAAGG + Intergenic
981586714 4:146311116-146311138 AATTAAGCCCTGATGTCCTAAGG - Intronic
981815303 4:148824488-148824510 ACTTAACCACAGATTGCCTAAGG + Intergenic
982157004 4:152533637-152533659 AATTAAGAAAAGATGAACTGAGG + Intronic
984084527 4:175292454-175292476 AATTAGTCACAGCTGGACCAGGG - Intergenic
984676132 4:182549799-182549821 CATTAAGGACAGATAGAATAAGG + Intronic
985670640 5:1204834-1204856 AATTAGCTGCAGATGGACTAAGG - Intronic
986306479 5:6520404-6520426 AAGTCAGCAGAGATGGACCATGG + Intergenic
987159589 5:15127722-15127744 AATCAACTAAAGATGGACTAAGG - Intergenic
987420058 5:17709282-17709304 ATTCAAGCACAAATGAACTATGG - Intergenic
987592958 5:19956000-19956022 AATTATGAACATATGGAATAAGG + Intronic
988665623 5:33324160-33324182 AACTAAGCATAGAGGAACTAAGG - Intergenic
988733342 5:33995515-33995537 AATTAAGCACTTATGCACTATGG - Intronic
989346269 5:40433303-40433325 AATTAAGCCCAGATTGACCCAGG + Intergenic
991984721 5:72272863-72272885 AATGAAACAAAGATGGGCTAAGG + Intronic
993555864 5:89337172-89337194 AATTAACCCAAGATGGATTAAGG + Intergenic
998791776 5:145773577-145773599 AATTAAGCACAGATGGACTAAGG - Intronic
999798334 5:155009027-155009049 AGTTGAGCACTGATGGACAAAGG + Intergenic
1001360560 5:171081108-171081130 CTTTAAACTCAGATGGACTAGGG - Intronic
1001722991 5:173871776-173871798 AATTAACCACAGAAAGACCAGGG - Intergenic
1005754397 6:28912623-28912645 AATTATGCACATATACACTATGG - Intronic
1009361012 6:62814402-62814424 AATTAAGAACAGCATGACTATGG + Intergenic
1012762476 6:103319269-103319291 AACTGAACACAGATGAACTAAGG + Intergenic
1015051461 6:128845759-128845781 GATTAGGCACAAATGGCCTAAGG - Intergenic
1015375675 6:132507603-132507625 GATACAGCACAGATGGACTTTGG - Intronic
1021117868 7:16763879-16763901 AATTAAGAACAGAAGAACTGGGG - Intronic
1022212704 7:28227229-28227251 AATGAAGCACAGATTAAATATGG - Intergenic
1023089158 7:36601535-36601557 ACTGAAGCACAGAAGGATTAAGG - Intronic
1023266494 7:38411561-38411583 AACTCAGCACACATGGTCTAGGG + Intronic
1023455555 7:40334901-40334923 AATTAATTCCAGATGGATTAAGG - Intronic
1024768453 7:52689242-52689264 ATTTAAGCACAAATGGGTTAAGG - Intergenic
1027510719 7:79076268-79076290 AATTTAGAGCAGATGGACTGGGG + Intronic
1029563618 7:101320593-101320615 AATAAAGCTCAGATGGACTAAGG - Intronic
1030619695 7:111775483-111775505 AAGTAAGAGCAGATGGACTGAGG + Intronic
1030733898 7:113021267-113021289 AAATAAGCACATATGGAGAATGG + Intergenic
1030740134 7:113099669-113099691 GTTTAAACACAGATGGACTATGG + Intergenic
1030811376 7:113976374-113976396 AAATAAGCACAGATGGAGAGTGG - Intronic
1031275726 7:119720760-119720782 AATTCAGAACAGATGGAGGAAGG - Intergenic
1033581645 7:142742496-142742518 ACTTAAGCACAGCTGGAAAAAGG + Intergenic
1035581541 8:743135-743157 ACTTAACCACAGAAGGACAAGGG + Intergenic
1036212884 8:6856736-6856758 AAATAAGCCCAGATGGATTTAGG + Intergenic
1037698333 8:21248078-21248100 AGTACAGCACAGATGGACTCTGG + Intergenic
1038975575 8:32692208-32692230 AATTTAGCACAGTTGGCCTCTGG + Intronic
1039935087 8:42036053-42036075 AAATAAGCACAGATGTATTTAGG + Intronic
1040873644 8:52127162-52127184 AATTAAGCACACATTTATTAAGG - Intronic
1041882533 8:62768396-62768418 CATTAAGCACAGAAAGATTATGG - Intronic
1042508993 8:69591716-69591738 ATTTAAGGACAGATAAACTAAGG + Intronic
1043705733 8:83347623-83347645 CATTAAGCACAGATTGAAAATGG - Intergenic
1044921003 8:97169477-97169499 ATGGCAGCACAGATGGACTAAGG - Intergenic
1046031363 8:108787132-108787154 AATTGATGACAGATGGACGAGGG - Intronic
1046229658 8:111336259-111336281 AATTAAGCCCAGATGCCCTAAGG + Intergenic
1050435191 9:5601346-5601368 CATTAAGGACAAATGGACTAGGG - Intergenic
1052470229 9:28884570-28884592 AATTATTTACAGATGGACAAAGG - Intergenic
1052771337 9:32693738-32693760 AAATAAGCACACATGGAGAATGG - Intergenic
1052900356 9:33788463-33788485 ACTTAAGCACAGCTGGAAAAAGG + Intronic
1057715408 9:97491277-97491299 ATTTAAGAACAGATGGATAATGG - Intronic
1186086665 X:5998003-5998025 TATTAAGCAAAGTTAGACTAAGG - Intronic
1189630712 X:42949798-42949820 ATCTAAGAACAGATGTACTATGG + Intergenic
1192701324 X:73477398-73477420 AATTAAGTCAAGATGGATTAGGG - Intergenic
1193712399 X:84894915-84894937 AGTCAAGCACTGATGGTCTAAGG - Intergenic
1194087907 X:89551942-89551964 AATTAAGCACAGAATGATTTGGG - Intergenic
1194871046 X:99131658-99131680 AATTAGGTACAAGTGGACTAAGG - Intergenic
1197019786 X:121673100-121673122 ACTAAAGCAAAGATGGCCTAAGG - Intergenic
1199397349 X:147354599-147354621 AATTAACCCAAGATGGATTAAGG + Intergenic
1199678755 X:150210002-150210024 AATCAAGTCCAGATGGATTAAGG - Intergenic
1199731428 X:150636910-150636932 AATTAAAGACAGAGGGACTTTGG - Intronic
1200440713 Y:3208859-3208881 AATTAAGCACAGAATGATTTGGG + Intergenic