ID: 998792791

View in Genome Browser
Species Human (GRCh38)
Location 5:145783510-145783532
Sequence CTGTTAAAAATCAGAATTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998792790_998792791 -6 Left 998792790 5:145783493-145783515 CCTGGTCTAGAAATAAGCTGTTA 0: 1
1: 0
2: 2
3: 14
4: 130
Right 998792791 5:145783510-145783532 CTGTTAAAAATCAGAATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998792791 Original CRISPR CTGTTAAAAATCAGAATTCT TGG Intronic
No off target data available for this crispr