ID: 998795634 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:145815492-145815514 |
| Sequence | TGTCCTGGAATTAGTGTTGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 339 | |||
| Summary | {0: 1, 1: 4, 2: 26, 3: 73, 4: 235} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 998795634_998795639 | 15 | Left | 998795634 | 5:145815492-145815514 | CCATCAACACTAATTCCAGGACA | 0: 1 1: 4 2: 26 3: 73 4: 235 |
||
| Right | 998795639 | 5:145815530-145815552 | AAAAGAAACTCCGTACCAACTGG | 0: 1 1: 0 2: 3 3: 21 4: 162 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 998795634 | Original CRISPR | TGTCCTGGAATTAGTGTTGA TGG (reversed) | Intronic | ||