ID: 998795634

View in Genome Browser
Species Human (GRCh38)
Location 5:145815492-145815514
Sequence TGTCCTGGAATTAGTGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 4, 2: 26, 3: 73, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998795634_998795639 15 Left 998795634 5:145815492-145815514 CCATCAACACTAATTCCAGGACA 0: 1
1: 4
2: 26
3: 73
4: 235
Right 998795639 5:145815530-145815552 AAAAGAAACTCCGTACCAACTGG 0: 1
1: 0
2: 3
3: 21
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998795634 Original CRISPR TGTCCTGGAATTAGTGTTGA TGG (reversed) Intronic