ID: 998797209

View in Genome Browser
Species Human (GRCh38)
Location 5:145833362-145833384
Sequence GCTCCTTTGTAAAGTCTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998797209_998797216 30 Left 998797209 5:145833362-145833384 CCAAAAAGACTTTACAAAGGAGC 0: 1
1: 0
2: 0
3: 17
4: 213
Right 998797216 5:145833415-145833437 GCCAGTTCTAACAAAAAAATTGG No data
998797209_998797212 -10 Left 998797209 5:145833362-145833384 CCAAAAAGACTTTACAAAGGAGC 0: 1
1: 0
2: 0
3: 17
4: 213
Right 998797212 5:145833375-145833397 ACAAAGGAGCAGTGGCTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998797209 Original CRISPR GCTCCTTTGTAAAGTCTTTT TGG (reversed) Intronic
901579072 1:10225579-10225601 GCTCCTGTCTAAAGTCTTGATGG - Intronic
902065243 1:13680373-13680395 TTTCCTTTGTAAAGAATTTTAGG + Intergenic
908333818 1:63099102-63099124 GTTCTTTTGTCAAGCCTTTTGGG - Intergenic
912231996 1:107805126-107805148 GCTTCTTGGTAAAGCCTTATTGG + Intronic
913064615 1:115239115-115239137 GCTTCCTGGTAGAGTCTTTTTGG - Intergenic
913458307 1:119056863-119056885 GATTATTGGTAAAGTCTTTTGGG + Intronic
914780230 1:150779240-150779262 GCTACTTTGTTAAGTCTCTGAGG + Intergenic
915831972 1:159139830-159139852 GCTCATTTCTAGAGTCTTTCTGG - Intronic
917630137 1:176883499-176883521 GCTCCTTTATAAAATTTTCTTGG + Intronic
918476437 1:184929993-184930015 GATCCTTTGGAAGCTCTTTTGGG - Intronic
922394620 1:225183597-225183619 GATCCTTTGTATAGATTTTTGGG - Intronic
923386872 1:233473438-233473460 CCTCCATTGTACAGTTTTTTTGG - Intergenic
924416782 1:243864214-243864236 ACTTCTTTTGAAAGTCTTTTTGG - Intergenic
1062933155 10:1365683-1365705 GCTCCTTTGGAAAGCATTTTGGG + Intronic
1063094155 10:2894630-2894652 GTTTTTTTGTAGAGTCTTTTTGG - Intergenic
1064455010 10:15479308-15479330 GCCACTTTGTAAAGTCTCTGTGG - Intergenic
1064625009 10:17252727-17252749 GCTGCTTTATAAAGTATTTAGGG - Intergenic
1064970795 10:21064597-21064619 GCTCCTTTATTAAGTGTTGTTGG + Intronic
1066064796 10:31754302-31754324 TCTCCTTTGTGAAGTCTGATAGG + Intergenic
1066299414 10:34083619-34083641 GCTCCTTTGTAACACCTCTTTGG - Intergenic
1066500888 10:35993510-35993532 GCTCCTTTGATTACTCTTTTTGG - Intergenic
1068977229 10:63023019-63023041 GCTCCTTGAGAAAGTCTCTTGGG - Intergenic
1069138448 10:64794619-64794641 GCTCATTTCTAAAGTTATTTTGG - Intergenic
1074229605 10:111520784-111520806 ACTCCTTTTTGAAGTCTTATAGG + Intergenic
1074955911 10:118389065-118389087 GGTCCTTTGTATATCCTTTTTGG + Intergenic
1074957315 10:118404825-118404847 GCTCCTCTGTAGTCTCTTTTTGG + Intergenic
1075175586 10:120157658-120157680 GGTCCTTTTTAAAGTCATTTTGG + Intergenic
1077676393 11:4197352-4197374 TTTCCTATGTAAAGTCATTTTGG + Intergenic
1078518305 11:12043868-12043890 GCTTCTATGTGAGGTCTTTTTGG + Intergenic
1079899809 11:26168163-26168185 GTTACTTTGTAATGTTTTTTTGG - Intergenic
1080119361 11:28658737-28658759 GCTCCTTGGGAAAGTATTCTGGG + Intergenic
1081730043 11:45365210-45365232 TCACATCTGTAAAGTCTTTTGGG + Intergenic
1082865110 11:57892307-57892329 GTTCTTTGGTAAAGTCTTTAGGG + Intergenic
1082959692 11:58906487-58906509 GGTGCTTTTTAAGGTCTTTTAGG + Intronic
1085089168 11:73695179-73695201 AAACCTTTGTAAAGTTTTTTTGG - Intronic
1085473146 11:76771027-76771049 CCTCCTTTGCAAAATCTTTCTGG + Intergenic
1085953600 11:81364002-81364024 GTTCCTTTTGAAAGTGTTTTAGG + Intergenic
1086455577 11:86955905-86955927 TCTCCTCTGTAAAGTCACTTGGG + Intergenic
1088496872 11:110440238-110440260 GATCCTTTGTATAGATTTTTGGG + Intronic
1092078658 12:5694484-5694506 GCTTCTCTGTAAACTCTTTGTGG - Intronic
1092130725 12:6111074-6111096 GCTCGCTTGTAAAGACTTTTTGG - Intronic
1093275809 12:17124036-17124058 TGACCTTTGTAAAGACTTTTTGG - Intergenic
1093574836 12:20714925-20714947 GTTCCTTGGTGAAGTCTCTTGGG + Intronic
1095596585 12:43966014-43966036 GTTCCTTTGTTAACTCGTTTAGG + Intronic
1096158509 12:49356697-49356719 GCTTCCTTGTAATGTCTTTCTGG + Intronic
1096218966 12:49815858-49815880 GCTCCTTGGAAAAGTGTTTGTGG - Intronic
1097933981 12:65224588-65224610 CCTGCTTTGTAAAGTATTTTGGG + Intronic
1098836952 12:75434947-75434969 GCTCCTTTGTATCATTTTTTTGG + Intergenic
1100271384 12:93028752-93028774 GATTCTCTGTAAAGTCTTTTTGG + Intergenic
1100416633 12:94384756-94384778 GTTTCTTTGCTAAGTCTTTTGGG + Intronic
1100885330 12:99063696-99063718 CCTCAGTTGTAAAGTGTTTTAGG + Intronic
1101695634 12:107123060-107123082 GCTCTTTTGTCTAGTGTTTTGGG + Intergenic
1101735232 12:107458483-107458505 CCTCCTTTGGAAAGTCTTCAAGG + Intronic
1102517055 12:113456771-113456793 ACTCCTCTGTAAACTCTTTGTGG + Intergenic
1104166235 12:126232488-126232510 TCTCCTTGGTAAAGACATTTGGG + Intergenic
1105879939 13:24595482-24595504 GGTCCTTAGTAGAGTCTGTTTGG + Intergenic
1105919914 13:24953632-24953654 GGTCCTTAGTAGAGTCTGTTTGG - Intergenic
1106446672 13:29839485-29839507 GCTCCTTTGTGGGGTTTTTTTGG - Intronic
1108830168 13:54467934-54467956 GCTCCTTTGTAATATGTGTTTGG - Intergenic
1109383735 13:61599981-61600003 TCACCATTGTAAACTCTTTTAGG + Intergenic
1109421796 13:62122129-62122151 GCAAATTTGTGAAGTCTTTTTGG - Intergenic
1112534152 13:100233681-100233703 GGTCCTCAGTAAAGTATTTTTGG + Intronic
1112702688 13:102030231-102030253 TGTACTTTGTAAAGTCTTCTTGG + Intronic
1112735660 13:102413692-102413714 GATCCTTAGTAAAGTCTTCTTGG - Intergenic
1115940631 14:38604798-38604820 CATCCTTTACAAAGTCTTTTGGG - Intergenic
1116071385 14:40050066-40050088 GATCCTTTGTACAGTTCTTTAGG + Intergenic
1116220165 14:42074831-42074853 GATCCCTTGTACAGTGTTTTTGG + Intergenic
1119053444 14:71393460-71393482 GCCGATTTGTAAAGTCTTATTGG + Intronic
1121330723 14:93047901-93047923 GCTCCTTGTGAAAGTCATTTTGG - Intronic
1124889767 15:33721990-33722012 TCTCCTTGGTAAAGTTTTATTGG - Intronic
1127333400 15:57960438-57960460 CTTCCTTTGTGAAGTCTTCTAGG + Intronic
1128828303 15:70741959-70741981 GATCCATTGTAAACACTTTTGGG - Intronic
1129129356 15:73478942-73478964 GCTTTTTTGTAAATTCTTTAGGG + Intronic
1131573613 15:93564407-93564429 GCTCCTGTTTAAAGTCTATCAGG + Intergenic
1132267538 15:100488160-100488182 GCTCATGTGTATAGTATTTTAGG + Intronic
1139647444 16:68341789-68341811 GACCCTTTGAAATGTCTTTTCGG - Intronic
1140597360 16:76432144-76432166 GCTCCTTTGTACTATTTTTTAGG + Intronic
1144451212 17:15380730-15380752 TGTCCTTTGTGAAGTATTTTAGG - Intergenic
1145364749 17:22250155-22250177 GCTCTTTTGTACAGTCTATGAGG - Intergenic
1148082265 17:44973785-44973807 CCTCCTCTGTAAAGTCTTCTTGG - Intergenic
1151541697 17:74767966-74767988 GCTCCTTTTTACATTCCTTTGGG - Intronic
1156571300 18:38256548-38256570 TCTCGTTTGTAAAGTCTTTGAGG + Intergenic
1157334158 18:46725202-46725224 GCTGTTTGGTAAAGACTTTTAGG - Intronic
1158415310 18:57245161-57245183 GCTCCTTTGCAAAGTCCTGGGGG + Intergenic
1158666153 18:59434450-59434472 GCTCCTTTGTAACGTTGTTGAGG - Exonic
1159645227 18:70910369-70910391 GCTCCTTTGTTAAATAATTTTGG - Intergenic
1159750062 18:72289280-72289302 ACCCTTTTGTAAAGTATTTTGGG + Intergenic
1159955426 18:74515461-74515483 GCTTCTGTGTACAGTGTTTTAGG + Intronic
1160974489 19:1785966-1785988 GCTCCTTTAAAAGGTTTTTTTGG - Intronic
1167586698 19:50379389-50379411 ACTCCTCTGAAAAGCCTTTTTGG - Intronic
1167813918 19:51861752-51861774 GCTACTTTGTAAACTCTCATTGG - Intronic
926024622 2:9530619-9530641 TCTCCTTTGTAGATTTTTTTTGG - Intronic
926463418 2:13162116-13162138 GCTCCATTTTATAGTCTTTATGG - Intergenic
928263341 2:29787577-29787599 GCTCCCTTGTAAAGCCTTCCTGG - Intronic
929336287 2:40750668-40750690 GCTCTTTTATAAAATATTTTTGG + Intergenic
929652288 2:43692400-43692422 TTTCCTTTTTGAAGTCTTTTAGG + Intronic
929940135 2:46327466-46327488 GCTCCTGTCTAAAGTCTCTGTGG - Intronic
930734953 2:54768444-54768466 GCTCTTTTGTAAAGTTTTCAGGG + Intronic
930972799 2:57417883-57417905 GCTCCTTTATCAAGTTTGTTTGG + Intergenic
931024148 2:58089798-58089820 CCTCATTTGTAAACTCTTCTGGG - Intronic
932449142 2:71798608-71798630 GCTCCCTTGTAAAGGCCCTTTGG + Intergenic
934313238 2:91890031-91890053 ACTTCTTTTTAAAGTATTTTTGG - Intergenic
934483839 2:94682083-94682105 GCTTCTTTGAAAATTGTTTTAGG + Intergenic
934908815 2:98231463-98231485 GCACCTTTGTCAAATCATTTGGG - Intronic
939344335 2:140943949-140943971 GATCCTTTGTATGGTATTTTGGG - Intronic
939370683 2:141296077-141296099 GCTCCTTTGTACATAATTTTGGG - Intronic
939710792 2:145516859-145516881 TTTCCTTTGTAAAGTTGTTTTGG - Intergenic
940075350 2:149735402-149735424 GTTCCTTTCTAAAGTCTCTTTGG + Intergenic
940458257 2:153929611-153929633 GTTCCTGTGTTAATTCTTTTAGG + Intronic
940517024 2:154696274-154696296 GCTCATTTGTAATCTCTTCTTGG + Intergenic
941082430 2:161077614-161077636 GAACCATTGTAAAGTCATTTAGG - Intergenic
942637782 2:178026700-178026722 TCTGCTTTTTAAAGTTTTTTAGG + Intronic
942837950 2:180323304-180323326 GCTCCTGTCCAAATTCTTTTAGG + Intergenic
944634091 2:201657719-201657741 GCATCTTTGTAAAGCCTGTTGGG + Intronic
945035299 2:205699280-205699302 GCTTCTTTATAAGGTGTTTTGGG + Intronic
945535645 2:211014595-211014617 GCTCTTTTGTAAAATCAATTTGG + Intergenic
1169320672 20:4630933-4630955 CCTCCTTTATAAAGTGCTTTGGG - Intergenic
1170017158 20:11794619-11794641 GCTCCTCTGTGAACTCTTTAAGG - Intergenic
1170044915 20:12074849-12074871 GCTACTTTGTAAATACTTCTGGG + Intergenic
1170337900 20:15291274-15291296 TCTCATCTGTAAAGTCTTTTGGG + Intronic
1173452175 20:43174633-43174655 TCTCCTCTGTATACTCTTTTGGG + Intronic
1174332239 20:49829554-49829576 GCTTCTTTGTGAAATTTTTTTGG + Intronic
1176741131 21:10603251-10603273 GGTCCTTAGTAGAGTCTGTTTGG + Intronic
1181834612 22:25593226-25593248 ACTTCTTTGTTAAGTTTTTTGGG + Intronic
1184896868 22:47413908-47413930 GCTTCTTTGTGAAGTATTTGTGG - Intergenic
949343981 3:3059532-3059554 GGAACTTTGGAAAGTCTTTTTGG + Intergenic
950429828 3:12944349-12944371 GCTCCTTTGTACAGTTGATTAGG - Intronic
951938647 3:28052487-28052509 GCTCCTTTGTCAAGTAAGTTCGG - Intergenic
953252934 3:41262846-41262868 GCTGCTTTGGGAAGTCTTTTAGG + Intronic
953525524 3:43687268-43687290 GCTGCTTTGTAAATATTTTTTGG - Intronic
953583465 3:44178140-44178162 TATCCTTTGTAATGTCCTTTAGG - Intergenic
953840104 3:46383252-46383274 GCTCCTTTTGAAAGCCTTTTAGG + Intergenic
957551682 3:81713459-81713481 TCTCCTCTGTAAAGTTTTTAAGG - Intronic
957988362 3:87598973-87598995 GCTTCTAGGTAAAATCTTTTGGG + Intergenic
958482925 3:94667120-94667142 CCTCCTTTGGAAAGGCTTATCGG - Intergenic
959291272 3:104477350-104477372 GCTCCTAAATAATGTCTTTTTGG + Intergenic
960374620 3:116884239-116884261 GCTTCTCTGTAGAGCCTTTTTGG + Intronic
963677097 3:148325986-148326008 GCTCCTGTGTTAATTCTCTTAGG - Intergenic
965629270 3:170714321-170714343 GCTTCTCTGTTCAGTCTTTTAGG + Intronic
966079711 3:175985890-175985912 GATCCTTTGTATAGTTTTTGGGG + Intergenic
967916631 3:194583266-194583288 ACTCCTTTTTAAAATCTTTTGGG - Intergenic
968848455 4:3061355-3061377 CCTCCTTTGGAAAGGCTTATCGG - Intergenic
970625481 4:17873865-17873887 GTCCCTTTTGAAAGTCTTTTTGG + Intronic
971837089 4:31781304-31781326 CCAGATTTGTAAAGTCTTTTGGG - Intergenic
972703949 4:41522376-41522398 TCTCCTCTGGAAAGTCTTTCAGG + Intronic
972962291 4:44468493-44468515 ATTCCTTTGTAAATTTTTTTGGG - Intergenic
975362778 4:73490737-73490759 CCTTCTTTTTAATGTCTTTTTGG + Intronic
975954398 4:79820668-79820690 GCTCCTATGACAAGTCTGTTAGG + Intergenic
977238947 4:94543081-94543103 GATCCTTTTAAAACTCTTTTTGG + Intronic
977492200 4:97729974-97729996 GTTCCTTGGTGAAGTCTTTAGGG + Intronic
979631897 4:122912093-122912115 CCTCCTTTGAGAAGTCTTTGGGG + Intronic
979878603 4:125926308-125926330 GTTCCTTCTTAAAGTTTTTTAGG - Intergenic
980751993 4:137102669-137102691 GCTGTTTTGTAGAGTCTTTAGGG - Intergenic
982481730 4:155920533-155920555 GCTCCTCTTTCAAGGCTTTTTGG - Intergenic
984221630 4:176984828-176984850 GATCCTTTGTATAGATTTTTGGG - Intergenic
984595649 4:181664303-181664325 GCTCATTTGTATAGTTTTTGTGG - Intergenic
985430713 4:189877063-189877085 GCTGCCTTCTAAAGTCTCTTCGG - Intergenic
986988157 5:13522335-13522357 GCTTGTTTGTAAAGTTTCTTGGG - Intergenic
989308801 5:39988567-39988589 GTTCCTTGATAAAGTGTTTTAGG - Intergenic
992220759 5:74570221-74570243 GCTTTTTGGTAAAGTCTTTGGGG + Intergenic
992354488 5:75967170-75967192 GCTAATTTTTAAAGTTTTTTTGG - Intergenic
992629405 5:78666161-78666183 GCTCCTTTGCAGAGTCTTCCTGG + Intronic
992888722 5:81184725-81184747 GTTCCTCTGTAAACTCCTTTGGG - Intronic
993266048 5:85727691-85727713 GCTACTTTGGAAAGTAGTTTGGG + Intergenic
994772423 5:103999905-103999927 GCTGCTTTGCAAATTCTTTTGGG - Intergenic
995140423 5:108728756-108728778 GATCCTTTTTAAAGGTTTTTAGG - Intergenic
996240498 5:121194519-121194541 CCTCCATTGTTAAGTATTTTGGG + Intergenic
996483859 5:124007376-124007398 GTTCATTTATAATGTCTTTTAGG - Intergenic
997968135 5:138376303-138376325 GCTCCCTTGCAAAGTACTTTTGG + Intronic
998797209 5:145833362-145833384 GCTCCTTTGTAAAGTCTTTTTGG - Intronic
999624935 5:153510838-153510860 GTTCATTTTTAAAGTGTTTTAGG + Intronic
1001726603 5:173907824-173907846 GCTCTTTTGGACAGTCTTGTGGG + Intronic
1001988418 5:176095548-176095570 GCTCCTCTGTCCAGGCTTTTGGG - Intronic
1002228450 5:177742585-177742607 GCTCCTCTGTCCAGGCTTTTGGG + Intronic
1003890006 6:10555751-10555773 GCTCCATTGTAATGCTTTTTTGG - Intronic
1004513762 6:16304625-16304647 GTTCCTTTGAAAATTCATTTTGG - Exonic
1004634600 6:17454596-17454618 GCTTCTTTATAAATACTTTTGGG + Intronic
1005155206 6:22797074-22797096 GCTCTTTTGTATGGACTTTTTGG + Intergenic
1006468903 6:34214765-34214787 GCACATTTGTATATTCTTTTTGG + Intergenic
1008090289 6:47286632-47286654 GCTCCTATGTAACATCTTCTTGG - Intronic
1008480069 6:51977075-51977097 GCTTCTCTGTAAAGCCTATTTGG + Intronic
1009302868 6:62049176-62049198 CCACCTATGTATAGTCTTTTTGG - Intronic
1010800673 6:80171366-80171388 GCTGCCCTGTAAAGTATTTTAGG - Exonic
1011957739 6:93044285-93044307 GCTTCTCTAGAAAGTCTTTTGGG + Intergenic
1013786924 6:113791986-113792008 GTTGCTTTTTAAAGTCTTTGAGG + Intergenic
1014438921 6:121451281-121451303 GCTCCTTTATAATTTGTTTTTGG + Intergenic
1015210470 6:130692284-130692306 GCTTCTTTGTATAGATTTTTGGG - Intergenic
1015711486 6:136146196-136146218 GCTCATATGTAAAGTAATTTGGG - Intronic
1015720630 6:136237466-136237488 GCTTCTTGTTAAAATCTTTTTGG - Intronic
1017185194 6:151593601-151593623 TCTCCTCTGTAAAGTCTTCAAGG + Intronic
1018045966 6:159966838-159966860 GCTGTTTAGTACAGTCTTTTGGG + Intergenic
1019400557 7:850195-850217 GCTCCCTTGTAAATATTTTTTGG + Intronic
1020541500 7:9464387-9464409 GAACCTTTGTAAAGTATGTTTGG + Intergenic
1020900382 7:13996304-13996326 GCTCCTCTGTAAGATCTTTCCGG + Intergenic
1021469082 7:20980864-20980886 GCTTCCTTGTAATGTCTGTTTGG + Intergenic
1029548622 7:101224376-101224398 GCTGCTTCTTTAAGTCTTTTTGG + Intergenic
1031423431 7:121577031-121577053 ACTCATTTATAAAGTCTTATAGG + Intergenic
1031531737 7:122885394-122885416 GCAGCTTTGTAAAGTGTTTGTGG - Intronic
1036542260 8:9728259-9728281 ACTACTTTCTAAAGTCTCTTGGG - Intronic
1036563323 8:9916553-9916575 GCTAGATTGTAAAGTCTTTGAGG + Intergenic
1038170868 8:25130272-25130294 GATCCTTTGTATAGGTTTTTAGG - Intergenic
1039065369 8:33603042-33603064 TTTCCTCTGTAAAGCCTTTTTGG + Intergenic
1042154049 8:65822172-65822194 AGACCTTTGTAAAGTCTTTAAGG + Intronic
1043018096 8:74966258-74966280 GCTGCTTTGTATAGTCATTTAGG - Intergenic
1044294389 8:90510721-90510743 AATCCTTTGTAGAGTCTTTTGGG - Intergenic
1044370258 8:91402161-91402183 GCTACTTTTTAAAATCTTCTTGG + Intergenic
1047104853 8:121720878-121720900 TTTCCTGTGTATAGTCTTTTTGG - Intergenic
1049511621 8:143029869-143029891 GGTCTTTTAAAAAGTCTTTTCGG + Intergenic
1050520578 9:6494470-6494492 GCTCTTTTGTAATGTCTTAAGGG - Intronic
1050748896 9:8912994-8913016 TCTATTTTGAAAAGTCTTTTAGG + Intronic
1051524406 9:18027178-18027200 GGTCCTTTGTATAGATTTTTGGG + Intergenic
1053251072 9:36574229-36574251 GCTCCCTTGCAAAGGCTTCTGGG - Intronic
1053673944 9:40402303-40402325 GCTTCTTTGAAAATTGTTTTAGG - Intergenic
1053923747 9:43028670-43028692 GCTTCTTTGAAAATTGTTTTAGG - Intergenic
1054385047 9:64542369-64542391 GCTTCTTTGAAAATTGTTTTAGG - Intergenic
1054510682 9:65973987-65974009 GCTTCTTTGAAAATTGTTTTAGG + Intergenic
1055327916 9:75151276-75151298 ACTCATTTTTAAAGTATTTTAGG - Intergenic
1185577996 X:1188765-1188787 GTTCCTTTGTTAATTCTCTTAGG - Intronic
1185962140 X:4556211-4556233 TCTCCTTTGTAGAGTCCCTTTGG + Intergenic
1189720976 X:43917340-43917362 GCTCTCTGGGAAAGTCTTTTTGG + Intergenic
1193287161 X:79726185-79726207 GCTGATTTTTAAAGTCTTTATGG - Intergenic
1193744743 X:85263256-85263278 TCTCCACTGTATAGTCTTTTAGG - Intronic
1194439657 X:93916347-93916369 GTTCCTGTGTAAATTCTCTTAGG - Intergenic
1194736364 X:97516593-97516615 CCTCCTCTGTGAAGACTTTTTGG - Intronic
1195376903 X:104236757-104236779 GCTAATTTTTAAAATCTTTTTGG - Intergenic
1198022528 X:132672987-132673009 TCTCCTTTGTAAGCTCTTTTCGG + Intronic
1198160190 X:134000283-134000305 GGTCCTTTATAGAGTCTGTTGGG - Intergenic
1198475304 X:136991137-136991159 GTTCCTTATTAATGTCTTTTAGG - Intergenic
1201351263 Y:13044287-13044309 GATCCTTTGTATTGGCTTTTTGG - Intergenic
1201752292 Y:17446089-17446111 TCTTCTTTTTAGAGTCTTTTTGG + Intergenic
1202599391 Y:26577113-26577135 GGTCCTTAGTAGAGTCTGTTTGG + Intergenic