ID: 998797212

View in Genome Browser
Species Human (GRCh38)
Location 5:145833375-145833397
Sequence ACAAAGGAGCAGTGGCTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998797209_998797212 -10 Left 998797209 5:145833362-145833384 CCAAAAAGACTTTACAAAGGAGC 0: 1
1: 0
2: 0
3: 17
4: 213
Right 998797212 5:145833375-145833397 ACAAAGGAGCAGTGGCTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998797212 Original CRISPR ACAAAGGAGCAGTGGCTTAA GGG Intronic
No off target data available for this crispr