ID: 998797480

View in Genome Browser
Species Human (GRCh38)
Location 5:145835309-145835331
Sequence AGGGCTCCGCAGAGGCCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 259}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998797470_998797480 9 Left 998797470 5:145835277-145835299 CCGGCCACGCCTCCGCGAGCTCA 0: 1
1: 0
2: 1
3: 8
4: 102
Right 998797480 5:145835309-145835331 AGGGCTCCGCAGAGGCCCGGAGG 0: 1
1: 0
2: 2
3: 20
4: 259
998797469_998797480 16 Left 998797469 5:145835270-145835292 CCGCGCACCGGCCACGCCTCCGC 0: 1
1: 0
2: 2
3: 29
4: 319
Right 998797480 5:145835309-145835331 AGGGCTCCGCAGAGGCCCGGAGG 0: 1
1: 0
2: 2
3: 20
4: 259
998797472_998797480 0 Left 998797472 5:145835286-145835308 CCTCCGCGAGCTCAGAGCTGCCC 0: 1
1: 0
2: 4
3: 17
4: 192
Right 998797480 5:145835309-145835331 AGGGCTCCGCAGAGGCCCGGAGG 0: 1
1: 0
2: 2
3: 20
4: 259
998797466_998797480 25 Left 998797466 5:145835261-145835283 CCGCGGGCCCCGCGCACCGGCCA 0: 1
1: 0
2: 1
3: 37
4: 299
Right 998797480 5:145835309-145835331 AGGGCTCCGCAGAGGCCCGGAGG 0: 1
1: 0
2: 2
3: 20
4: 259
998797467_998797480 18 Left 998797467 5:145835268-145835290 CCCCGCGCACCGGCCACGCCTCC 0: 1
1: 0
2: 1
3: 17
4: 268
Right 998797480 5:145835309-145835331 AGGGCTCCGCAGAGGCCCGGAGG 0: 1
1: 0
2: 2
3: 20
4: 259
998797471_998797480 5 Left 998797471 5:145835281-145835303 CCACGCCTCCGCGAGCTCAGAGC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 998797480 5:145835309-145835331 AGGGCTCCGCAGAGGCCCGGAGG 0: 1
1: 0
2: 2
3: 20
4: 259
998797468_998797480 17 Left 998797468 5:145835269-145835291 CCCGCGCACCGGCCACGCCTCCG 0: 1
1: 0
2: 4
3: 20
4: 181
Right 998797480 5:145835309-145835331 AGGGCTCCGCAGAGGCCCGGAGG 0: 1
1: 0
2: 2
3: 20
4: 259
998797473_998797480 -3 Left 998797473 5:145835289-145835311 CCGCGAGCTCAGAGCTGCCCAGG 0: 1
1: 1
2: 1
3: 44
4: 449
Right 998797480 5:145835309-145835331 AGGGCTCCGCAGAGGCCCGGAGG 0: 1
1: 0
2: 2
3: 20
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998797480 Original CRISPR AGGGCTCCGCAGAGGCCCGG AGG Intronic
900130804 1:1086374-1086396 CGGGCTCAGCACAGGCCCTGGGG + Intronic
900299048 1:1967621-1967643 AGGGCACCGCAGAGACCCTGTGG + Intronic
900474454 1:2869631-2869653 AGGGCTCCCCACAGGCCCCAAGG + Intergenic
900496927 1:2979936-2979958 CGGGCCCCGCAGAGCCCCTGTGG + Intergenic
901244817 1:7721534-7721556 TGGCCTCGGCAGAGGCCCAGAGG + Intronic
901290068 1:8117165-8117187 ATGGTTCCCCAGAGGCCTGGAGG + Intergenic
902089122 1:13888974-13888996 AAGGTTCTGCAGAGCCCCGGGGG - Intergenic
902594366 1:17498202-17498224 AAGGTTCTGCAGAGCCCCGGGGG + Intergenic
904200967 1:28818797-28818819 AGGGCTGAGGAGAGGCCTGGAGG + Intronic
905199576 1:36306861-36306883 GGGGCTCCGGAGAGGCGCGGAGG + Exonic
905939531 1:41852245-41852267 TGGGCTCCTCAGAGCCCCGTGGG + Intronic
907307136 1:53519721-53519743 AGGGGCCCGCAGAGTCCCAGGGG + Intronic
907606145 1:55819067-55819089 ACAGCTCCTCAGAGGCCCAGTGG + Intergenic
915835343 1:159171643-159171665 CGGGCTCCGAAGCGGCTCGGGGG + Exonic
916058499 1:161083764-161083786 TGGGCTCCAAAGAGGCCCGTGGG - Intronic
918449120 1:184641997-184642019 TGGGCTTCCCAGAGGCCTGGTGG - Intergenic
920274982 1:204798047-204798069 AGGGCTGCTCAGAGGCCAGCTGG + Intergenic
923740287 1:236648299-236648321 AGGGATCCTCTGAGCCCCGGAGG + Intergenic
1065204394 10:23343860-23343882 AGGGCTCCGGGGCGGGCCGGCGG + Intronic
1065268536 10:24002474-24002496 AGGCCTCCTCAGATGCCCAGTGG + Intronic
1065289472 10:24215275-24215297 TGGGCTCTGCAGAGGCTGGGAGG + Intronic
1065559051 10:26944206-26944228 ATGGCTCCGCAGAAGCCCTGTGG + Intergenic
1069438349 10:68406703-68406725 AAGGCTGCCCAGAGGCCTGGGGG + Intronic
1069661446 10:70126216-70126238 AGGGCTCAGCACAGGCCAGGAGG - Intronic
1070307004 10:75245680-75245702 ATGGATCTGCAGAGGCCCTGGGG - Intergenic
1072626605 10:97116379-97116401 AGGGCTCCGGACAGGCCCTAAGG - Intronic
1072660400 10:97360301-97360323 AGGGCTCCTCAGAAGGCTGGTGG + Intronic
1073040248 10:100599283-100599305 AGGGGTGCGCAGCTGCCCGGAGG - Intergenic
1073452950 10:103620219-103620241 AGTGCTTCCCAGAAGCCCGGAGG - Intronic
1073509553 10:104034683-104034705 AGGGCTCCTGAGACACCCGGGGG + Exonic
1073577814 10:104640497-104640519 AGGGGTTCGCAGGGGGCCGGCGG - Intergenic
1074123500 10:110510384-110510406 AGAGCTCAGCAGAAGCCCTGTGG + Exonic
1075430342 10:122374933-122374955 AGGCGTCCGCAGAGGGGCGGTGG + Intronic
1075653264 10:124143997-124144019 ATGGATCCTCAGAGGCACGGGGG + Intergenic
1075666431 10:124234016-124234038 AGGGCTGCGGAAAGGCCTGGTGG - Intergenic
1078652822 11:13211862-13211884 AGTGCTCTGCAAAGGCCCTGTGG + Intergenic
1079006449 11:16794605-16794627 AGGGGTCCGCACAGGGCTGGTGG + Exonic
1079248381 11:18769869-18769891 AGGCCTCAGCAGAGGCACGTGGG + Intronic
1081644617 11:44781067-44781089 AGGTTTCTGCAGAGGGCCGGAGG + Intronic
1081748368 11:45488840-45488862 AGGACTGTGCAGAGGCCCAGTGG - Intergenic
1083720914 11:64603133-64603155 ATGGCCCCCCAGAGGCCCAGGGG - Intergenic
1083883137 11:65558096-65558118 AGGGGACCGCGGGGGCCCGGCGG + Exonic
1083904984 11:65663310-65663332 TCTGCTCCGCAGAGGCCGGGTGG + Intergenic
1084271130 11:68029783-68029805 AGGGACCCGCAGAGGCCCCGAGG - Intergenic
1084371528 11:68748092-68748114 GGGGCTCCCCAAAGGCCAGGAGG + Intronic
1084450679 11:69234832-69234854 AGGGGTCAGCAGAGCCCTGGAGG - Intergenic
1086917537 11:92547892-92547914 AGGGCTGTGCAGAGGCTCTGGGG + Intronic
1087142296 11:94776593-94776615 AGGGCTCTGCACACGCCCTGTGG + Intronic
1089466858 11:118691054-118691076 AGGGCCGTGCAGAGGCCCTGAGG - Intergenic
1089565442 11:119368848-119368870 AGGGCTGGGCAGAGGCCAGCGGG + Intronic
1090806933 11:130208704-130208726 AGGGCTCCGCAGAGGGCCTGGGG + Intronic
1091297201 11:134482297-134482319 AGGGCTCTGCAGACCCCCGCAGG - Intergenic
1095310498 12:40692465-40692487 TGGGCTCCGCCGAGGCGAGGAGG + Intronic
1096506129 12:52094678-52094700 AGGGCGCTGCAGAGGCCAAGAGG - Intergenic
1096518172 12:52169865-52169887 AGTGCTCCCCACAGGCCTGGAGG + Exonic
1096829138 12:54300934-54300956 AGCGCTCAGCAATGGCCCGGGGG - Intronic
1096971052 12:55666727-55666749 AGGGCTACTCAGAGGTCCCGAGG + Intergenic
1101903365 12:108807782-108807804 AGGCCTGCGAAGTGGCCCGGAGG - Exonic
1102484661 12:113247595-113247617 AGGGCACGGCAGGGGCCGGGTGG - Intronic
1103058781 12:117842370-117842392 AGGGCTGTGCAAAGGCCCTGGGG + Intronic
1103547608 12:121713069-121713091 AGTGCCCCGGAGAGGCCCTGGGG + Intronic
1103931477 12:124453171-124453193 AGGGCTGCACAAAGGCCTGGCGG + Intronic
1104120229 12:125791654-125791676 AGGGCTCCCCAAATGCCTGGTGG - Intergenic
1104983413 12:132583672-132583694 CCGGCTCCGCGGCGGCCCGGGGG - Exonic
1105239187 13:18595380-18595402 AGCCCTCCTCAGAGACCCGGGGG - Intergenic
1105882883 13:24618887-24618909 AGGCGTGCGCAGAGGCCTGGGGG + Intergenic
1110436375 13:75481783-75481805 AGGGCACCGCGGAGGCCGGCCGG + Exonic
1112208263 13:97347096-97347118 CGGCCTCCGCAGAGGCGCCGGGG - Intronic
1113174120 13:107541971-107541993 AGGGCTCCACAGAGACCTTGAGG - Intronic
1113517491 13:110914769-110914791 AGGAGTCCTCAGAGGCCAGGTGG + Exonic
1115852438 14:37598759-37598781 TGGGCACCGCAGAGCCCCGCCGG - Intronic
1117353601 14:54902968-54902990 GCGGCTCCGGAGACGCCCGGAGG + Intergenic
1118770275 14:68938259-68938281 AGGTCTCAGCAGAGGCCTGGTGG - Intronic
1118920070 14:70142010-70142032 AGGGCTCCACAGAGCCCAGCTGG + Intronic
1119413572 14:74454741-74454763 ATGGTTCTGCAGAGCCCCGGGGG - Intergenic
1121183518 14:91947398-91947420 AGGGCTCTGCAGTGGCTGGGAGG - Exonic
1121524813 14:94612536-94612558 AGGGGTAAGCAGAGGCCAGGAGG + Intronic
1121709948 14:96030389-96030411 AGGGGTCCACAGAGGCCTTGGGG - Intergenic
1122142212 14:99669068-99669090 AGGGCTGGACAGAGGCCTGGAGG - Intronic
1122790307 14:104181589-104181611 AGGACTCCGAAGAGGCCAGGAGG - Intergenic
1122992094 14:105241264-105241286 CCTGCTCCGCAGAGGCCCGAGGG + Exonic
1123492063 15:20788704-20788726 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1123548567 15:21357794-21357816 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1125125073 15:36210636-36210658 GGGGCATCACAGAGGCCCGGAGG - Intergenic
1125300966 15:38252908-38252930 AGGGATCCGAGGAGGCCCGGTGG - Exonic
1127311030 15:57752579-57752601 TGGGCTTCCCAGAGGCCCCGTGG + Intronic
1128334031 15:66774569-66774591 AGGGCTCCACAGTGGCCCAGGGG - Intronic
1128550848 15:68596987-68597009 AGGGCTCCGCAGAAGTCCTCAGG + Intronic
1128672978 15:69588070-69588092 AGAGCTCAGCTGAGGCCCAGAGG - Intergenic
1129519331 15:76176164-76176186 TGGGCTCAGCAGAGGCAAGGGGG + Intronic
1129540849 15:76346272-76346294 TGGGCCCCGCAGAGCTCCGGGGG + Intergenic
1130838254 15:87672820-87672842 AGGGCTCCCCAAAGGCCAAGTGG - Intergenic
1131581741 15:93649895-93649917 ATGGCGCCTCAGAGGCCCCGGGG - Intergenic
1202956901 15_KI270727v1_random:85025-85047 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1132556997 16:576927-576949 AGGCCTCCACAGAGGCCCGAGGG - Intronic
1132575515 16:662063-662085 AGTGCCCCGCAGAAGCCCTGTGG + Intronic
1132604507 16:788177-788199 CGCGCCCCGCACAGGCCCGGTGG + Intronic
1132745469 16:1434478-1434500 AGGGCCCTGCGGAGGCCAGGAGG - Exonic
1132764504 16:1527353-1527375 AGGGTTCTGCAGAGCCCTGGAGG + Intronic
1132768184 16:1545638-1545660 AGGGCTCGGCAGAGGTGGGGTGG + Intronic
1132803119 16:1763812-1763834 GGGGCCCCGCAGAGGCGGGGCGG + Intronic
1132994409 16:2815502-2815524 AGGGATCCGCTGAGGCCCCTAGG - Intergenic
1133023391 16:2976757-2976779 AGGGCTCTGCAGAGTCTCTGAGG + Exonic
1135323476 16:21511977-21511999 CGCGCTCCCCAGAGGCCCTGTGG - Intergenic
1136334964 16:29605242-29605264 CGCGCTCCCCAGAGGCCCTGTGG - Intergenic
1139588823 16:67921635-67921657 AGGGTTCCGCTGAGGCCAAGTGG - Intronic
1139692494 16:68650147-68650169 AGGCCTGCCCAGGGGCCCGGTGG - Intronic
1139953688 16:70683667-70683689 AGGGCCTCCCAGAGGCCCAGGGG + Intronic
1140922230 16:79550127-79550149 TGGGCTCTGCAGATGCCCTGGGG - Intergenic
1141440386 16:84026058-84026080 AGGGCACGGCAGATGCCCCGAGG + Intronic
1142105318 16:88299387-88299409 AGGGCTTCGGAGAGGCCGGAGGG + Intergenic
1142243686 16:88958751-88958773 TGGGCTACGCTGAGGCCCTGAGG - Intronic
1142427608 16:90008967-90008989 AAGGCTGCTCAGAGCCCCGGGGG + Intronic
1142560755 17:807582-807604 AGTGCTCCTCAGAAGCCAGGTGG - Intronic
1143020434 17:3914719-3914741 AAGGCACAGCAGAGGCCTGGGGG + Intronic
1143115145 17:4577729-4577751 GGGCCTCCGCAGAGGCCTGTGGG + Intergenic
1143779499 17:9221906-9221928 AGGGCCCCGCAGTGGCCAGCGGG + Intronic
1145012462 17:19377755-19377777 CGGGCTCCGCAGAGGAGCAGAGG + Exonic
1145395480 17:22490740-22490762 AGGGCTGGGCAGAGCCCCTGAGG + Intergenic
1146912890 17:36659550-36659572 AGGGGTCTGCCGAGGCCTGGGGG + Intergenic
1147733470 17:42618683-42618705 AGGGCAGCTCAGAGGCCAGGTGG + Intergenic
1148769876 17:50060547-50060569 GGGGCTCCGCAGAGGCCAAGAGG + Intronic
1148936309 17:51166658-51166680 CGGGCTCCGCAGAGGGACGCCGG + Exonic
1149865939 17:60150954-60150976 CCGGCTCCGCAGAGGCCTTGGGG - Intronic
1151568762 17:74915638-74915660 AGGGCCCTCCAGAGGCCCAGAGG - Intergenic
1151785247 17:76272129-76272151 AGGGGCCCGAGGAGGCCCGGAGG - Intergenic
1152403363 17:80082766-80082788 GGGGCTCGGCGGGGGCCCGGGGG - Intronic
1152521746 17:80860470-80860492 AGGGCTGAGCAGGGGCCCAGGGG - Intronic
1152628377 17:81398776-81398798 CCGGCTCCTCAGAGCCCCGGAGG - Intronic
1152795895 17:82306088-82306110 AGGGCAGCGCAGAGGGTCGGGGG - Intergenic
1152799262 17:82323410-82323432 AGGGCTCACCAGATGCCCTGGGG + Intronic
1152845552 17:82597483-82597505 AGGTCTCAGCAGAGGCTCGGAGG - Intronic
1153226794 18:2906309-2906331 AGGGCTGCGCGGAGGCCGTGAGG - Intronic
1154140736 18:11822107-11822129 GCGGCTCCGGAGAGGCCCAGGGG + Intronic
1154266853 18:12885868-12885890 AGGGCTGCACTGAAGCCCGGGGG + Intronic
1154449605 18:14463260-14463282 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1158381208 18:56932167-56932189 AGGGCTCTGCAGTGACCTGGAGG - Intronic
1160819657 19:1052156-1052178 AGGGCTGAACAGAGTCCCGGGGG - Intronic
1160855439 19:1215157-1215179 TGGGCTCGGCAAAGGCCCCGGGG - Intronic
1160871067 19:1278286-1278308 CGGGCTGCGCAGATGCCGGGCGG + Intronic
1160987292 19:1844945-1844967 AGGGCTCTCCAGAGGTGCGGTGG - Intronic
1161237464 19:3205031-3205053 AGGGCCCTGAAGAGGCCCAGAGG - Intronic
1161397346 19:4051845-4051867 AGGGCCACGCAGAGGCGGGGTGG + Intronic
1161871501 19:6874006-6874028 AAGGTTCTGCAGAGCCCCGGGGG + Intergenic
1163032342 19:14552967-14552989 AGTGCTCCTCGGAGGCCCTGAGG + Intronic
1163690339 19:18735237-18735259 AGGGCTGGGCAGAGGCCTGAGGG + Intronic
1164989290 19:32673139-32673161 AGGTGTCTGCAGAGGGCCGGGGG - Intronic
1165631349 19:37304651-37304673 AGGACTCCGGAGAGGCCAGCCGG - Intergenic
1167499344 19:49836526-49836548 AGAGCTCCGCAAAGGCCATGGGG - Intronic
1167569155 19:50276195-50276217 GGAGCTCCGGTGAGGCCCGGTGG + Exonic
1167609913 19:50502039-50502061 AGGGCTCTGCAGAGGCTGGCGGG - Intergenic
1168295168 19:55374606-55374628 GGGGCTCTGCAGGGGGCCGGGGG - Intergenic
1168351920 19:55680835-55680857 AGGGCTCCGGAGAGGGCCAAAGG - Intronic
925306461 2:2850663-2850685 AAGGCTCCGCAGAGGAGCGGAGG - Intergenic
927853889 2:26516163-26516185 AGGCCTCCCCAGTGGCCCTGAGG - Intronic
928607920 2:32961249-32961271 AGAGCTCGGCAGAGACCCGGAGG - Intronic
932209478 2:69915250-69915272 CGGGCTCCACAGCGGTCCGGCGG + Exonic
934038194 2:88106432-88106454 AGGCCTCCTCAAAGGCCTGGAGG - Exonic
934530645 2:95085637-95085659 AGGCCTCAGCAGAGGTCCCGAGG + Intergenic
937103863 2:119292412-119292434 AGGGCTCTGCGTATGCCCGGAGG - Intergenic
937989952 2:127656802-127656824 ATGGCTCCGTAGAGGCCCGTGGG + Intronic
938481834 2:131669487-131669509 AGCCCTCCTCAGAGACCCGGGGG - Intergenic
946397244 2:219449162-219449184 GAGGCTTCGCAGAGGGCCGGAGG + Exonic
946909070 2:224442633-224442655 GGGGCCCCGCGAAGGCCCGGGGG - Intergenic
948378280 2:237536643-237536665 AGTGTTCCGCAGGGGCCTGGGGG - Intronic
1168848017 20:958665-958687 AGGGCTCCCCAGCTGCCAGGTGG + Exonic
1171280231 20:23890039-23890061 CGGGTTCTGCAGAGGCCCGTCGG + Intergenic
1173824056 20:46035962-46035984 GGGGCTTGGCAGAGGCCTGGGGG + Intronic
1175895622 20:62334449-62334471 AGGGACACGGAGAGGCCCGGAGG + Intronic
1175937940 20:62523532-62523554 AGGGCTCTGGGGAGGGCCGGGGG - Intergenic
1178484208 21:33006963-33006985 ATGGCCCTGCAGAGTCCCGGTGG - Intergenic
1179217606 21:39380834-39380856 AGGGTTTCCCAGAGGCCTGGCGG + Intronic
1179621280 21:42617781-42617803 CGTGCTCAGCAGAGGCGCGGGGG - Intergenic
1179718958 21:43304791-43304813 AGGGGTCAGCAGAGCCCCCGTGG + Intergenic
1179817548 21:43917324-43917346 AGGGCTCAGCAGAGACCCGGAGG - Intronic
1180077283 21:45469168-45469190 AGGGCTTGGCACAGGCCTGGGGG - Intronic
1180109469 21:45641452-45641474 AGGCTCCCGCAGAGGACCGGGGG + Intergenic
1181024130 22:20117864-20117886 CAGGCTCTGCAGAGGCCTGGGGG + Intronic
1181182529 22:21078047-21078069 AGGGGTCAGCAGAGCCCCGAAGG - Intergenic
1181406509 22:22688781-22688803 AGGGATTCTCAGAGGCCAGGTGG + Intergenic
1181414469 22:22749415-22749437 AGGGATTCTCAGAGGCCAGGTGG + Intronic
1181543074 22:23584253-23584275 AGGGCTCTGCAGAGGCACCAGGG - Intergenic
1182776888 22:32837909-32837931 ATGGTTGGGCAGAGGCCCGGAGG - Intronic
1183230383 22:36578445-36578467 AGGTCTCCCCAGAGCCCCAGTGG - Intronic
1183977825 22:41523458-41523480 AGGGCCCTGCAGAGGCACTGGGG + Intronic
1184004768 22:41699907-41699929 CGGGCTCCACGGAGGCCCGCAGG - Intronic
1184536570 22:45091655-45091677 AGGGATCCGCAGGGCCCCCGAGG - Intergenic
1184663145 22:45974755-45974777 TGGGCTACACGGAGGCCCGGTGG + Intronic
1184738686 22:46414359-46414381 AGGGCTGCACAGAGGAGCGGGGG + Intronic
1185045338 22:48525765-48525787 AGGCCCCTGCAGAGGCACGGTGG + Intronic
1185222191 22:49634669-49634691 AGTGGTCGGCAGAGGCCCGTTGG - Intronic
950487010 3:13279865-13279887 AGGGCTGCCCAGAGGCTAGGTGG - Intergenic
950773723 3:15332437-15332459 TGGGCTCCGGAGCGCCCCGGGGG + Exonic
953807951 3:46087871-46087893 AGGGTTCAGGAGAGGCCCAGTGG + Intergenic
961676780 3:128572389-128572411 CGGGCAGCGCAGAGGCCTGGAGG + Exonic
961817763 3:129560068-129560090 AGGGTACAGCAGAGGCCCAGAGG - Intronic
963599116 3:147361805-147361827 AGGGCTCTGAAGAGGCCCCCAGG + Intergenic
965884296 3:173424804-173424826 AGGGCTCAGCAGAAGGCAGGAGG - Intronic
966570073 3:181431238-181431260 AGGGCTCAGAAGAGGCCCTGTGG + Intergenic
967122558 3:186395977-186395999 AGGGAACCACAGTGGCCCGGGGG - Intergenic
967893359 3:194378893-194378915 AGGGCTGAGCAAAGGCCTGGAGG + Intergenic
968597218 4:1491746-1491768 AGGGGGACGCAGAGGCCCGAGGG - Intergenic
968742611 4:2339178-2339200 AGGGCTTTGGAGAGGCCCGAGGG - Intronic
970394669 4:15654745-15654767 AGAGCCCCGAACAGGCCCGGGGG + Intronic
973843318 4:54885315-54885337 AGGGCTCCACAGAGGACCAAAGG + Intergenic
985621448 5:958304-958326 AGGGCTGAGCAGGGGCCCCGTGG - Intergenic
985643436 5:1074250-1074272 AGGCCCCCGCCGAGGCCCTGAGG + Intronic
985773039 5:1824990-1825012 AGGGCTCCAAAGTGGCCAGGCGG - Intergenic
990263208 5:54047539-54047561 AGGGCATCGCTGTGGCCCGGAGG + Intronic
993904087 5:93604201-93604223 AGGGCTCCGCGGGGGCACGGGGG + Intergenic
994213279 5:97109234-97109256 AGGGCTCCTCCCAGGCCCGGAGG - Intronic
996234422 5:121108607-121108629 AGAGCTGAGCAGAGGCCCGGCGG - Intergenic
998797480 5:145835309-145835331 AGGGCTCCGCAGAGGCCCGGAGG + Intronic
998879705 5:146633651-146633673 AGGGCTGGGCAGAGGCCTGAAGG + Intronic
999135909 5:149318832-149318854 AGGGGTCCACAGAGGGCCAGTGG + Intronic
999318387 5:150598834-150598856 AGGGGTCCCCAGAGGCCTGAAGG + Intergenic
1002564011 5:180100002-180100024 AGGGCTCTGCCCAGGCCCTGCGG + Intergenic
1003672746 6:8174577-8174599 AGAGGACGGCAGAGGCCCGGAGG + Intergenic
1011054774 6:83193447-83193469 AGGCCCCCGCGGTGGCCCGGGGG + Intronic
1012916877 6:105179991-105180013 CGGGCTCCGGAGCGGCGCGGCGG + Intronic
1017026581 6:150186411-150186433 AGGGCTCAGCAAAAGCCCAGTGG - Intronic
1018665059 6:166127782-166127804 AGGGCTCCACAGAGGCCTTTGGG - Intergenic
1018892263 6:167990439-167990461 GAGGCTCCCCAGAGCCCCGGGGG - Intergenic
1019161256 6:170068250-170068272 AGGGCACTGCAAAGGCCCAGTGG + Intergenic
1019161273 6:170068310-170068332 AGGGCACTGCAAAGGCCCAGTGG + Intergenic
1019338783 7:498099-498121 TGGGCTCTGCAGGGGCCCGCAGG - Intronic
1019598438 7:1869204-1869226 TGGGGGCCACAGAGGCCCGGGGG + Intronic
1019651158 7:2159327-2159349 AGGGCTGTGCAGAGGACCTGAGG - Intronic
1020088557 7:5324494-5324516 GGGGCACCCCAGAGGCCAGGGGG + Intronic
1020261016 7:6530918-6530940 CGGGCTCCGCCCAGGCTCGGAGG + Intronic
1020959647 7:14786819-14786841 ATGGCTCGGCATAGGCCCGCAGG + Intronic
1021591645 7:22269959-22269981 AAGGTTCTGCAGAGCCCCGGAGG + Intronic
1023852174 7:44156674-44156696 AGGGGTCCTCATAGGCCCTGCGG - Intronic
1024579867 7:50793073-50793095 CGGGCCCCGCGGAGGCGCGGCGG - Intronic
1025205753 7:56992620-56992642 GGGGCACCCCAGAGGCCAGGGGG - Intergenic
1025666187 7:63584318-63584340 GGGGCACCCCAGAGGCCAGGGGG + Intergenic
1026969594 7:74459898-74459920 AGGGCTCAGTGGAGGCCCCGGGG + Intronic
1029460914 7:100693703-100693725 AGGGCTTGGCAGGGGCCCGGGGG + Intergenic
1029605995 7:101599691-101599713 TGGGCTAGGCAGAGTCCCGGGGG - Intergenic
1029708282 7:102286712-102286734 CGGGCTCCGCGGATGGCCGGGGG + Intronic
1035169812 7:157010951-157010973 GGGGCTCTCCAGGGGCCCGGGGG - Intergenic
1035448418 7:158958445-158958467 TCTGCTCCGCAGTGGCCCGGGGG - Intergenic
1035520435 8:272008-272030 GGGGCGCCCCAGAGGCCAGGCGG + Intergenic
1035745518 8:1959895-1959917 AGGGCTCTGCAGAGGAGAGGGGG - Intergenic
1037916318 8:22775440-22775462 AGGGGTGCGCAGGGGCCCGTGGG + Intronic
1039442501 8:37604978-37605000 AGGGCTCTGCAGAGCCCTGCTGG - Intergenic
1040039152 8:42897940-42897962 AGGGATGCGCAGAGCCCGGGCGG + Intronic
1040415276 8:47189396-47189418 GGGGCTCTGCACAGGCCAGGAGG + Intergenic
1040544991 8:48392178-48392200 AGGTCTTCCCAGAGGCCCAGTGG + Intergenic
1040915433 8:52563730-52563752 AGGGCTCCCCAGTGGCCGGCTGG + Intronic
1044621041 8:94190980-94191002 AGGGCTTGGCAGTGGCCCAGGGG - Intronic
1045432096 8:102123919-102123941 AGGGCCGCGCAGAGGCGCGTGGG - Intronic
1047732059 8:127736148-127736170 AGGGCTTCTCAGAGGCTTGGCGG + Exonic
1049509376 8:143019687-143019709 AGGGGCCCGCAGAGGCCCTAAGG - Intronic
1049639961 8:143711086-143711108 TGGGCTGGGCAGAGGCCTGGGGG - Intronic
1049694622 8:143977253-143977275 AGGGGTCAGCAGAGCCCAGGAGG - Exonic
1049774386 8:144397768-144397790 CGGGGGCCGCAGTGGCCCGGAGG - Exonic
1053443534 9:38135020-38135042 GGGGCTCCGCAGAGGGATGGGGG + Intergenic
1056475163 9:86946267-86946289 TGGGCTGCACCGAGGCCCGGCGG - Exonic
1059471125 9:114505403-114505425 CGGGCGGCGCAGAGGCGCGGAGG - Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060770242 9:126327024-126327046 CGGGCGCCGCGGAGGCTCGGCGG + Intronic
1060854569 9:126904919-126904941 GGGGCTCGGCAGAGGCTCCGTGG - Intergenic
1061249774 9:129420005-129420027 AGCGCTCAGCAGATGCCTGGTGG + Intergenic
1061329199 9:129881584-129881606 TGGGTCCCGCAGAGGCCCTGAGG + Exonic
1061408525 9:130405780-130405802 AGGGCTGGGCAGGGGCACGGTGG + Intronic
1061791450 9:133061334-133061356 AGGGCCCAGCCGAGGCCCTGGGG - Intergenic
1061960070 9:133983398-133983420 AGGGCTCAACAGAGGCACAGGGG + Intronic
1062009014 9:134257152-134257174 AGAGCTCCACAGAGAGCCGGTGG - Intergenic
1062053417 9:134458611-134458633 AGGTCCCCCCAGAGGCCAGGAGG - Intergenic
1062082059 9:134629471-134629493 AGGGGTCCGCAGAGGAGCTGCGG - Intergenic
1062165116 9:135103758-135103780 AGAGCTCCACAGAGGTCAGGAGG - Intronic
1062567603 9:137170229-137170251 AGGGCTCGGCGGGCGCCCGGTGG - Intronic
1062702935 9:137917522-137917544 AGGGCTGGGCAGAGGCTCTGAGG - Intronic
1185449885 X:276335-276357 AGTGTCCCGCAGAGACCCGGCGG + Intronic
1185623092 X:1465351-1465373 CAGGCACTGCAGAGGCCCGGTGG - Exonic
1187473450 X:19589305-19589327 AGGGCTCAGCAGAGGGCTGAGGG + Intronic
1192657038 X:73003177-73003199 AGGTCGCGGCAGCGGCCCGGCGG + Intergenic
1192665082 X:73079824-73079846 AGGTCGCGGCAGCGGCCCGGCGG - Intergenic
1197226595 X:123961280-123961302 GGGTCTCCGTAGAGGCCCCGAGG - Intronic
1199329672 X:146544027-146544049 AGGCCTCCCCAGAAGCCAGGAGG - Intergenic
1200069407 X:153520291-153520313 AGGGCGCCCCAGAGCCCCAGGGG + Intronic