ID: 998798967

View in Genome Browser
Species Human (GRCh38)
Location 5:145848824-145848846
Sequence CTTCTTCAGCTCTGTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998798964_998798967 11 Left 998798964 5:145848790-145848812 CCTTGGACAAGTCTTTTGCCTGC No data
Right 998798967 5:145848824-145848846 CTTCTTCAGCTCTGTGAGCAAGG No data
998798965_998798967 -7 Left 998798965 5:145848808-145848830 CCTGCTCAGACCTTCACTTCTTC No data
Right 998798967 5:145848824-145848846 CTTCTTCAGCTCTGTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998798967 Original CRISPR CTTCTTCAGCTCTGTGAGCA AGG Intergenic
No off target data available for this crispr