ID: 998808392

View in Genome Browser
Species Human (GRCh38)
Location 5:145940838-145940860
Sequence CTAAGGCTCTCAAAGTGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 743
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 690}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998808392_998808393 -8 Left 998808392 5:145940838-145940860 CCAAAACACTTTGAGAGCCTTAG 0: 1
1: 0
2: 4
3: 48
4: 690
Right 998808393 5:145940853-145940875 AGCCTTAGATGAAAGACATTTGG 0: 1
1: 0
2: 1
3: 14
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998808392 Original CRISPR CTAAGGCTCTCAAAGTGTTT TGG (reversed) Intronic
900017749 1:165032-165054 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
900048008 1:523628-523650 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
900070226 1:765488-765510 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
901422073 1:9157889-9157911 CTCAGGCCCTCAAAGTGTTGGGG - Intergenic
901709625 1:11103557-11103579 CTTAGCTTCTCAAAGTGTTGGGG + Intergenic
902348819 1:15838196-15838218 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
902858412 1:19226363-19226385 CTTAGCCTCCCAAAGTGTTGAGG - Intronic
903108883 1:21110680-21110702 CTCAGCCTCCCAAAGTGCTTGGG + Intronic
903616438 1:24662194-24662216 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
903704480 1:25275036-25275058 CTTGGTCTCCCAAAGTGTTTGGG - Intronic
903722761 1:25418276-25418298 CTTGGCCTCCCAAAGTGTTTGGG + Intronic
904258755 1:29274797-29274819 CTCAGCCTCCCAAAGTGCTTGGG - Intronic
904668284 1:32141646-32141668 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
904685897 1:32260260-32260282 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
904777714 1:32921550-32921572 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
904800741 1:33091489-33091511 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
905575421 1:39040321-39040343 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
906505593 1:46377007-46377029 CTCAGCCTCCCAAAGTGTTCGGG + Intergenic
906573359 1:46863631-46863653 CTCAGCCTCTCAAAGTGCTGAGG - Intergenic
906598516 1:47103427-47103449 CTCAGCCTCTCAAAGTGCTGAGG + Intronic
906696337 1:47825815-47825837 CTGAGGCTCTAACAGTGTGTAGG + Intronic
907833263 1:58085617-58085639 CTCAGCCTCCCAAAGTGTTAGGG + Intronic
907972800 1:59400886-59400908 CTCAGCCTCTCAGAGTGCTTGGG + Intronic
908524884 1:64978026-64978048 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
909442378 1:75711995-75712017 CTTTGGCTCTCAAAGGATTTTGG + Intergenic
910963180 1:92783560-92783582 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
913134828 1:115878102-115878124 CTAGGCCTCCCAAAGTGTTGGGG + Intergenic
914213078 1:145599525-145599547 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
914216536 1:145635723-145635745 CTCAGCCTCTCAAAGCGTTAGGG - Intronic
914469104 1:147958403-147958425 CTCAGCCTCTCAAAGCGTTAGGG - Intronic
914804959 1:150984908-150984930 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
914904519 1:151732869-151732891 CTCAGCCTCCCAAAGTGCTTAGG - Intergenic
915188810 1:154130834-154130856 CTCAGCCTCTCAAAGTGCTGGGG + Intronic
915542290 1:156575299-156575321 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
916006748 1:160668523-160668545 CTCAGCTTCTCAAAGTGTTAGGG + Intergenic
916184885 1:162121368-162121390 CTCAGCCTCTCAAAGTGCTGGGG + Intronic
916185013 1:162122754-162122776 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
916410231 1:164539972-164539994 CTCAGGCTCCCAAAGTGCTGGGG + Intergenic
916477560 1:165184490-165184512 TTAAGGGTTTCAAAGTCTTTGGG + Intergenic
916853603 1:168727787-168727809 CCCAGCCTCCCAAAGTGTTTGGG + Intronic
917340421 1:173971211-173971233 CTCAGCCTCCCAAAGTGCTTGGG + Intronic
917881960 1:179345799-179345821 CTCAGCCTCTCAAAGTGCTGGGG + Intronic
917993462 1:180408903-180408925 CTCAGCCTCCCAAAGTGTTAGGG - Intronic
918484868 1:185018327-185018349 CTTGGCCTCTCAAAGTGTTGGGG - Intergenic
918764417 1:188460450-188460472 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
919684487 1:200470755-200470777 CTCAGCCTCTCAAAGTGTTGGGG + Intergenic
920409384 1:205747541-205747563 CAAATGCTCTTAAAATGTTTAGG + Intronic
921291555 1:213662527-213662549 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
922265932 1:223983526-223983548 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
922584284 1:226722062-226722084 CTCAGCCTCTCAAAGTGCTGGGG + Intronic
922776809 1:228218468-228218490 CTCAGCCTCCCAAAGTGCTTGGG + Intronic
923078168 1:230628868-230628890 CTCAGCCTCCCAAAGTGTTGAGG + Intergenic
923398913 1:233596298-233596320 CTAAGCCTCCCAAAGTGCTGGGG + Intergenic
923581717 1:235222932-235222954 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
924170415 1:241333607-241333629 CTAAGACTTACACAGTGTTTTGG - Intronic
1063263323 10:4415358-4415380 CTTGGCCTCTCAAAGTGTTTAGG + Intergenic
1063406145 10:5797293-5797315 CTCGGCCTCCCAAAGTGTTTGGG - Intronic
1063596375 10:7439603-7439625 CTCAGACTCCCAAAGTGTTGGGG + Intergenic
1063772141 10:9215651-9215673 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1063895024 10:10670915-10670937 CTCAGCCTCTGAAAGTGTTGAGG - Intergenic
1064002914 10:11678424-11678446 CTCAGTCTCCCAAAGTGCTTAGG - Intergenic
1064685180 10:17854201-17854223 CTCAGCCTCCCAAAGTGTTGAGG + Intronic
1064781427 10:18843419-18843441 CTAAGACTCTCAAAATATTTTGG + Intergenic
1064971405 10:21070923-21070945 CTCAGTCTCCCAAAGTGTTGGGG - Intronic
1065129310 10:22604569-22604591 CCTAGGCTCTCATAGTGTTTTGG - Intronic
1065507603 10:26444846-26444868 CTCAGCCTCCCAAAGTGTTTGGG - Intronic
1066100992 10:32118509-32118531 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1067265864 10:44744851-44744873 CTCAGCCTCCCAAAGTGTTAGGG - Intergenic
1067930296 10:50554173-50554195 AGAAGGCTCTTAAAGTTTTTAGG - Intronic
1068206592 10:53862971-53862993 CTAAGGAACTCAAAGTGATTTGG + Intronic
1068971607 10:62963907-62963929 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1069389881 10:67923405-67923427 AAAGGGCTCTCAAAATGTTTTGG - Intronic
1069478838 10:68761851-68761873 CTCAGCCTCTCAAAGTGCTGAGG + Intronic
1069573482 10:69508190-69508212 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1070081140 10:73188940-73188962 CTCAGCCTCTCAAAGTGTTGGGG - Intronic
1070236945 10:74638408-74638430 CTTAGCCTCTCAAAGTGTTGAGG - Intronic
1071067246 10:81650427-81650449 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1071160032 10:82734764-82734786 CTTGGCCTCCCAAAGTGTTTGGG - Intronic
1071309101 10:84326915-84326937 CTCAGCCTCTCAAAGTGTTGAGG + Intergenic
1072210299 10:93240131-93240153 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1072282331 10:93878119-93878141 CTAAGGAGCTCACAATGTTTTGG + Intergenic
1072953858 10:99871875-99871897 CTCAGCCTCACAAAGTGTTGGGG + Intergenic
1074333679 10:112546313-112546335 CTCAGCTTCTCAAAGTGCTTTGG - Intronic
1074656970 10:115602100-115602122 CTCAGGCTCCCAAAGTGCTAGGG - Intronic
1075043882 10:119130547-119130569 CTCAGCCTCTCAAAGTGCTGGGG + Intronic
1076197992 10:128534063-128534085 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1076628335 10:131835557-131835579 CTCAGCCTCCCAAAGTGTTGAGG - Intergenic
1076974347 11:160221-160243 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
1077668978 11:4140058-4140080 CTCAGCCTCTCAAAGTCTTGGGG + Intergenic
1078307962 11:10210052-10210074 CTCAGCCTCCCAAAGTGCTTGGG - Intronic
1078378660 11:10819247-10819269 CTTAGCCTCCCAAAGTGTTGGGG + Intronic
1078730420 11:13969126-13969148 CTCAGCCTCCCAAAGTGTTGAGG - Intronic
1079038256 11:17039601-17039623 CTCGGGCTCTCAAAGTGCTGGGG - Intergenic
1079067503 11:17309060-17309082 CTCAGCCTCTCAAAGTGCTGGGG - Intronic
1079207707 11:18431207-18431229 CTTAGGCTCCCAAAGTGTTGCGG - Intronic
1079506382 11:21156839-21156861 CTCAGCCTCTCAAAGTGCTGGGG - Intronic
1080400829 11:31934147-31934169 CTCAGCCTCTCAAAGTGCTGGGG - Intronic
1080411665 11:32030572-32030594 CCAACGCTCTCTATGTGTTTGGG + Intronic
1080530942 11:33175724-33175746 GTAAGGTTCTCATATTGTTTAGG + Intergenic
1081006970 11:37756769-37756791 CTCAGCCTCTCAAAGTGCTAGGG - Intergenic
1081337966 11:41890826-41890848 CTTGGACTCCCAAAGTGTTTAGG + Intergenic
1081720147 11:45282894-45282916 CTCAGCCTCTCAAACTGTTAGGG - Intronic
1081722152 11:45298167-45298189 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1082073290 11:47957003-47957025 CTCAGCCTCCCAAAGTGCTTAGG + Intergenic
1082284496 11:50303918-50303940 CTCGGCCTCCCAAAGTGTTTGGG + Intergenic
1083285200 11:61654332-61654354 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1084401998 11:68949769-68949791 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1084950915 11:72665055-72665077 CTCAGCCTCCCAAAGTGCTTGGG + Intronic
1085468081 11:76737745-76737767 CTCAGTCTCTCAAAGTGCTAGGG + Intergenic
1085645920 11:78222832-78222854 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1086885647 11:92202114-92202136 CTAAGAGTCTCAAGTTGTTTGGG - Intergenic
1086911553 11:92478508-92478530 CTAAGACTCTCAAAGGACTTGGG + Intronic
1086939249 11:92778539-92778561 CTTAGGAACTCAAACTGTTTTGG - Intronic
1087282964 11:96232720-96232742 CTCAGCCTCCCAAAGTGCTTAGG + Intronic
1087689059 11:101298111-101298133 CTTAGGCACTCATAGTATTTGGG + Intergenic
1087837726 11:102891520-102891542 CTTAGGCTCCCAAAGGGATTTGG + Intergenic
1088358667 11:108968955-108968977 CTCGGCCTCCCAAAGTGTTTGGG + Intergenic
1089758013 11:120700841-120700863 CTCAGCCTCCCAAAGTGCTTGGG + Intronic
1091180596 11:133600962-133600984 CTTTGGCTCTGCAAGTGTTTAGG - Intergenic
1091197228 11:133742074-133742096 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1091277797 11:134364130-134364152 CTTAGCCTCCCAAAGTGTTGGGG + Intronic
1091461561 12:647077-647099 CCAAGGCCCTCAAACTGTTCAGG + Intronic
1091571998 12:1695130-1695152 CTTAGCCTCCCAAAGTGTTAGGG + Intronic
1091578540 12:1763725-1763747 CTCAGCCTCTCAAAGTTGTTAGG - Intronic
1091748159 12:3005887-3005909 CTCAGGCTCCCAAAGTGCTGGGG + Intronic
1092189246 12:6506207-6506229 CTCAGCCTCTCAAAGTGGTGGGG + Intronic
1092201760 12:6588994-6589016 CTCAGCCTCGCAAAGTGTTGGGG - Intronic
1092225042 12:6742760-6742782 CTCAGCTTCCCAAAGTGTTTAGG + Intergenic
1092235398 12:6804763-6804785 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1092610367 12:10166093-10166115 CTCAGCCTCCCAAAGTGCTTGGG - Intronic
1093142405 12:15524550-15524572 CTGAGGATATCAAAGTCTTTTGG - Intronic
1093511030 12:19928535-19928557 CTCAGCCTCTCAAAGTGTTGGGG + Intergenic
1095084832 12:38049993-38050015 CTCAGTCTCCCAAAGTGTTGGGG + Intergenic
1095467440 12:42502560-42502582 CTTGGCCTCTCAAAGTGTTGGGG + Intronic
1095659634 12:44716049-44716071 CTAAGCCTCCCAAAGTGCTGGGG + Intronic
1096095423 12:48932362-48932384 CTAAGCCTCCCAAAGTGTTGAGG + Intronic
1096126929 12:49126515-49126537 CTCAGCCTCCCAAAGTGCTTGGG + Intergenic
1096213687 12:49786564-49786586 CTTGGCCTCTCAAAGTGCTTGGG + Intergenic
1096511887 12:52134907-52134929 CTCAGCCTCCCAAAATGTTTGGG - Intergenic
1096987113 12:55767292-55767314 CTCAGCCTCCCAAAGTGCTTGGG - Intronic
1097006147 12:55919403-55919425 CTCAGCCTCCCAAAGTGTTGAGG + Intronic
1097107020 12:56631956-56631978 CAAAGGCTCACAGAGTGTGTGGG + Intronic
1097204965 12:57313306-57313328 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1098169036 12:67727527-67727549 CTAACCCTCTCATTGTGTTTTGG + Intergenic
1098843639 12:75508953-75508975 ATAAGGCACTCAAAATGCTTAGG - Intronic
1100198656 12:92275345-92275367 CTCAGCCTCCCAAAGTGTTAGGG + Intergenic
1101092070 12:101297464-101297486 CTTGGCCTCTCAAAGTGTTGGGG + Intronic
1101416792 12:104515459-104515481 CTAAGGCTCTCAAATTTCTGAGG + Intronic
1101491774 12:105216260-105216282 CTAAGCCTCCCAAAGTGCTGGGG - Intronic
1101739493 12:107489870-107489892 CTCAGCCTCCCAAAGTGGTTGGG + Intronic
1102304726 12:111796007-111796029 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1102567195 12:113804503-113804525 CTCAGCCTCTCAAAGTGCTAGGG + Intergenic
1102664526 12:114559218-114559240 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1103126106 12:118423997-118424019 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1103361173 12:120354940-120354962 CTCAGGTTCCCAAAGTGTTGTGG - Intronic
1103441542 12:120966520-120966542 CTCAGCCTCTCAAAGTGTTGGGG + Intergenic
1103688176 12:122749444-122749466 GTAAGACTCTCAGAGTGTCTGGG + Intergenic
1104454618 12:128900885-128900907 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1105269386 13:18857096-18857118 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1105312327 13:19223386-19223408 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1105391930 13:19987730-19987752 CTCAGCCTCTCAAAGTGCTAGGG + Intronic
1106222975 13:27762335-27762357 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1107444145 13:40455489-40455511 CTCAGGCTCCCAAAGTGCTGGGG - Intergenic
1107485306 13:40821044-40821066 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1107852138 13:44580972-44580994 CTAAGCCTCCCAAAGTGCTGGGG - Intergenic
1108080296 13:46728166-46728188 CTCGGCCTCTCAAAGTGTTGGGG + Intronic
1109419548 13:62093617-62093639 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1109446841 13:62450449-62450471 CTCAGCCTCTCAAAGTATTAGGG + Intergenic
1111131360 13:83980622-83980644 CTAAGCCACTCACAGTGTGTAGG + Intergenic
1112110902 13:96297530-96297552 CTAACGCTGGCAAAGTGATTTGG - Intronic
1112214387 13:97415231-97415253 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
1112473292 13:99708841-99708863 CTCAGGCTCCCAAAGTTGTTGGG - Intronic
1112906024 13:104423445-104423467 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1113515214 13:110889684-110889706 CTCAGGATTCCAAAGTGTTTTGG + Intronic
1114320610 14:21544305-21544327 CTCGGGCTCTCAAAGTGCTGGGG - Intergenic
1115638915 14:35319121-35319143 CTAAGCCTCCCGAAGTGTTGGGG - Intergenic
1115687624 14:35812394-35812416 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1115696646 14:35906389-35906411 CTCAGCCTCTCAAAGTGCTGGGG + Intronic
1116229577 14:42199352-42199374 CTAGGCCTCCCAAAGTGTTGGGG - Intergenic
1118262894 14:64264617-64264639 CTCAGCCTCTCAAAGTGCTGGGG - Intronic
1119061684 14:71481225-71481247 CTCAGGTTCTCAAAGTGCTAGGG - Intronic
1119239015 14:73043391-73043413 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1119372938 14:74163331-74163353 CTCTGCCTCCCAAAGTGTTTGGG + Intronic
1119448813 14:74689994-74690016 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1119584372 14:75818748-75818770 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1119628881 14:76208755-76208777 CTCAGGCTTTCAAAGGGTTGAGG - Exonic
1119660053 14:76444635-76444657 CTCAGCCTCTCAGAGTGCTTAGG + Intronic
1120538487 14:85726578-85726600 CTCAGGCTCCCAAAGTGTTAAGG + Intergenic
1120628349 14:86857169-86857191 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1120955730 14:90080200-90080222 CTCAGCCTCTCAAAGTGCTGGGG - Intronic
1122767931 14:104084665-104084687 CTAAGGATCTTTAAGGGTTTAGG + Intergenic
1202829937 14_GL000009v2_random:16913-16935 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1124357270 15:29004929-29004951 CTTGGGCTCTCAAAGTGCTGGGG + Intronic
1125194509 15:37030890-37030912 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1125539418 15:40461319-40461341 CTAAGGCTTTCATAATGCTTGGG - Intronic
1125560651 15:40630401-40630423 CTAAGAATCTCAGAATGTTTTGG - Intronic
1125627269 15:41118577-41118599 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1125786595 15:42323752-42323774 CTGAGGCTCCCAAAGTGCTGGGG + Intronic
1125960610 15:43826821-43826843 CTCAGCCTCCCAAAGTGCTTAGG + Intergenic
1126330633 15:47526986-47527008 CTAAGCCTCCCAAAGTGCTGGGG + Intronic
1126436129 15:48639904-48639926 CTAAAACTCCCAAAGTGGTTAGG + Intronic
1126535184 15:49753951-49753973 CTAAGGCTCTCAAAATGAATTGG - Intergenic
1126763160 15:51988140-51988162 CTATGGGTCTGAAATTGTTTAGG - Intronic
1126840333 15:52711413-52711435 CTAGGGCTCTCAGAGTTTTTTGG + Intergenic
1127383396 15:58448555-58448577 CTCAGGCTCTCAGAGTGTGAAGG + Intronic
1127467653 15:59259837-59259859 CTGAGACTCTCAAAGTCATTAGG + Intronic
1127768248 15:62208739-62208761 CTCAGGCTCCCAAAGTGCTGGGG + Intergenic
1128088565 15:64903568-64903590 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1128199838 15:65795060-65795082 CTCAGTCTCTCAAAGTGTTGGGG + Intronic
1128465290 15:67905453-67905475 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1128652445 15:69428403-69428425 CTCAGCCTCCCAAAGTGCTTGGG - Intronic
1129277937 15:74459712-74459734 CTAGGCCTCTCAAAGTGCTAGGG - Intronic
1129435748 15:75538916-75538938 CTCAGCCTCACAAAGTGTTGGGG - Intronic
1130664612 15:85859367-85859389 CTAAGGGTCTCAGTGTGTGTTGG + Intergenic
1131658715 15:94490545-94490567 CTCAGCCTCACAAAGTGCTTCGG - Intergenic
1132290736 15:100701571-100701593 CTCAGCCTCTCAAAGTGCTAGGG - Intergenic
1132489199 16:216251-216273 CTCAGCCTCCCAAAGTGCTTGGG + Intronic
1132780553 16:1622259-1622281 CTCAGCCTCTCAAAGTGCTAGGG - Intronic
1132895147 16:2225380-2225402 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1133542402 16:6768976-6768998 CTCGGGCTCCCAAAGTGTTGAGG + Intronic
1133982689 16:10645256-10645278 CTCAGCCTCTCAAAGTGTTTAGG - Intronic
1134656900 16:15954278-15954300 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1134667521 16:16029473-16029495 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1134679362 16:16113402-16113424 CTTGGCCTCTCAAAGTGTTGGGG - Intronic
1134778109 16:16870799-16870821 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1135029169 16:19024177-19024199 CTCGGCCTCTCAAAGTGTTGGGG - Intronic
1135038230 16:19096283-19096305 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1135387866 16:22059923-22059945 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1135962520 16:27009492-27009514 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1136248240 16:28987158-28987180 CTCGGGCTCCCAAAGTGCTTGGG + Intronic
1136348782 16:29694064-29694086 CCCAGCCTCCCAAAGTGTTTGGG + Intronic
1137529929 16:49272729-49272751 CTAAGGTGCTCAAAGTATGTTGG + Intergenic
1137584515 16:49656257-49656279 CTCAGCCTCCCAAAGTGTGTGGG - Intronic
1137829611 16:51531490-51531512 CTCAGCCTCCCAAAGTGTTGAGG - Intergenic
1138322523 16:56128438-56128460 CTTGGCCTCTCAAAGTGTTAAGG - Intergenic
1138430786 16:56967402-56967424 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1138440612 16:57032742-57032764 CTCAGCCTCTCAAAGTGCTGGGG - Intronic
1138570938 16:57872626-57872648 CTCAGCCTCTCAAAGTGCTGTGG + Intergenic
1139088881 16:63619319-63619341 CAAAGGCTATGAAAGTGTGTAGG - Intergenic
1139465566 16:67152133-67152155 CTCAGCCTCCCAAAGTGTTGAGG - Intergenic
1139619033 16:68122190-68122212 CTTGGGCACTCAAAGGGTTTGGG - Exonic
1139730350 16:68938953-68938975 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1139786899 16:69400502-69400524 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1139827399 16:69768086-69768108 CTCAGCCTCCCAAAGTGTTTGGG + Intronic
1140431515 16:74908164-74908186 CTCAGCCTCTCAAAGTGCTGGGG - Intronic
1140580303 16:76223565-76223587 CCCAGGCTCTAAAGGTGTTTGGG + Intergenic
1141067979 16:80929271-80929293 CTAAGGAACTGAAAATGTTTTGG - Intergenic
1141681388 16:85546334-85546356 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1142445914 16:90137423-90137445 CTCAGCCTCCCAAAGTGCTTGGG + Intergenic
1203090583 16_KI270728v1_random:1210364-1210386 CTAAGGATCAGAAAGTGGTTAGG - Intergenic
1142461595 17:98038-98060 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
1142618331 17:1149666-1149688 CTTAGCCTCTCAAAGTGCTGGGG + Intronic
1142686833 17:1582054-1582076 CTCAGCCTCCCAAAGTGTTTTGG + Intronic
1142722785 17:1787974-1787996 CTTGGGCTCTAAAAGTCTTTGGG - Intronic
1142988543 17:3713103-3713125 CTTAGCCTCTGAAAGTGTTGGGG - Intergenic
1143853108 17:9827709-9827731 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1143889139 17:10088904-10088926 CTCAGCCTCTCAAAGTGCTGGGG - Intronic
1144022341 17:11248533-11248555 CTAAGGATCCCAAAGTTATTTGG - Intronic
1144458115 17:15435496-15435518 CTTGGCCTCTCAAAGTGTTGGGG - Intergenic
1144594320 17:16554423-16554445 CTCAGCCTCTCAAAGTGTTAGGG + Intronic
1144594662 17:16558549-16558571 CTCAGCCTCTCAAAGTGCTGGGG + Intronic
1144862295 17:18312863-18312885 CTTAGCCTCCCAAAGTGTTAGGG - Intronic
1145069800 17:19794825-19794847 CTCAGCCTCCCAAAGTGTTCTGG - Intronic
1146077140 17:29741863-29741885 CTAAGCTTCCCAAAGTGCTTGGG + Intronic
1146740985 17:35283320-35283342 CTCAGCCTCTCAAAATGTTAGGG - Intergenic
1147342124 17:39759162-39759184 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1147370239 17:39987597-39987619 CTCAGCCTCCCAAAGTGTTAGGG + Intronic
1147709361 17:42451371-42451393 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1147872794 17:43599415-43599437 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
1147941321 17:44050359-44050381 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1148008388 17:44453781-44453803 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1148038471 17:44687189-44687211 CTCAGTCTCTCAAAGTGCTGGGG - Intronic
1148286237 17:46395423-46395445 CTCAGTCTCCCAAAGTGTTGGGG - Intergenic
1148308403 17:46613014-46613036 CTCAGTCTCCCAAAGTGTTGGGG - Intronic
1149256329 17:54831552-54831574 CTCAGCCTCCCAAAATGTTTGGG - Intergenic
1150056112 17:62018451-62018473 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1150334269 17:64319190-64319212 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1150552466 17:66223404-66223426 CCAATGCTCTCATAGTGCTTTGG - Intronic
1150571184 17:66388543-66388565 CTTAGCCTCCCAAAGTGCTTAGG + Intronic
1150772166 17:68051396-68051418 CTAGGCCTCTCAAAGTGCTAGGG + Intergenic
1151646456 17:75435752-75435774 CTAAGCCTCCCAAAGTGCTGGGG + Intergenic
1152167605 17:78720621-78720643 CTCAGCCTCTCAAAGTGCTGGGG - Intronic
1152204266 17:78966031-78966053 CTCAGCCTCCCAGAGTGTTTGGG - Intergenic
1152691114 17:81718092-81718114 CTCAGGCTCCCAAAGTGCTGGGG - Intronic
1153689908 18:7581909-7581931 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1157059169 18:44267168-44267190 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1157140054 18:45096408-45096430 CTCAGCCTCCCAAAGTGCTTGGG + Intergenic
1157756532 18:50222817-50222839 ATAAGGCCCTCAAAATTTTTAGG + Intergenic
1158958044 18:62560970-62560992 CTAAGGTCCTCAAATTGTTTGGG - Intronic
1159489112 18:69106464-69106486 CTCAGTCTCCCAAAGTGTTGGGG + Intergenic
1159795773 18:72841479-72841501 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1160401016 18:78611522-78611544 CTGAGGCCCTCAAACTGTGTAGG + Intergenic
1160651295 19:230405-230427 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
1160819317 19:1050442-1050464 ATAAGGCTATCACAGGGTTTTGG + Intronic
1160947732 19:1651577-1651599 CCAAGTCTCTCAAAGTCCTTGGG - Intronic
1161486977 19:4541576-4541598 CTCAGTCTCTCAAAGTGCTGGGG + Intergenic
1161645254 19:5449407-5449429 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1161694765 19:5760114-5760136 CTCAGCCTCCCAAAGTGTTGTGG - Intronic
1161947378 19:7446144-7446166 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1162092205 19:8287832-8287854 CTCAGACTCTCAAAGTGCTGGGG - Intronic
1162206117 19:9057412-9057434 CTCAGCCTCTCAAAGTGTTGGGG - Intergenic
1162279993 19:9688186-9688208 CTAAGGAGCTCAAAGTGCTGGGG + Intergenic
1162380219 19:10327502-10327524 CTCAGCCTCCCAAAGTGTTAGGG + Intronic
1162397854 19:10427874-10427896 CTCAGCCTCCCAAAGTGTGTTGG - Intronic
1162436732 19:10664930-10664952 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1162660036 19:12161645-12161667 CTCGGCCTCTCAAAGTGTTGGGG + Intergenic
1162739121 19:12763941-12763963 CTTAGCCTCCCAAAGTGTTGAGG + Intronic
1162952900 19:14082369-14082391 CTAAGGGAAGCAAAGTGTTTGGG + Intronic
1163226575 19:15965713-15965735 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1163454414 19:17397990-17398012 CTCAGTCTCCCAAAGTGCTTGGG - Intergenic
1163469483 19:17488105-17488127 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1163802758 19:19377169-19377191 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1163910821 19:20190634-20190656 CTAGGTCTCCCAAAGTGTTAGGG + Intronic
1164629896 19:29755110-29755132 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
1164881071 19:31733497-31733519 CTCAGGCTCTCCAGGTGTCTTGG + Intergenic
1165037909 19:33047793-33047815 CTCAGCCTCTCAAAGTGCTTGGG - Intronic
1165543259 19:36509946-36509968 CTTAGCCTCCCAAAGTGCTTGGG - Intergenic
1166127551 19:40724695-40724717 CTCAGTCTCCCAAAGTGTTGGGG - Intronic
1166352854 19:42208476-42208498 TTAGGGTTTTCAAAGTGTTTAGG - Intronic
1166575807 19:43836590-43836612 CTCAGCCTCCCAAAGTGCTTGGG + Intronic
1166807033 19:45493543-45493565 CTCGGCCTCCCAAAGTGTTTAGG + Intronic
1167023428 19:46896151-46896173 CTAGGCCTCCCAAAGTGCTTGGG - Intergenic
1167093702 19:47362031-47362053 CTCAGGCTCCCAAAGTGATGGGG - Intronic
1167388965 19:49181781-49181803 CTCAGGCTCCCAAAGTGCTGGGG + Intronic
1168373996 19:55860323-55860345 CTCAGCTTCTCAAAGTGTTGGGG - Intronic
1168569561 19:57454712-57454734 CTCAGCCTCTCAAAGTGCTGGGG + Intronic
1202642749 1_KI270706v1_random:110872-110894 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
925538075 2:4937638-4937660 CCAAGTCTCTCAAAACGTTTGGG + Intergenic
926623829 2:15072875-15072897 CTCAGCCTCTCAAAGTGTTGGGG - Intergenic
927502216 2:23590492-23590514 CAAAGGCTCCCAGAGTGTTCAGG - Intronic
927688408 2:25189223-25189245 CTTAGCCTCCCAAAGTGTTGCGG - Intergenic
927825515 2:26306848-26306870 CTCAGACTCTCAAAGTGCTGGGG + Intergenic
928443356 2:31311880-31311902 CTTAGGCACTCACAGTATTTGGG + Intergenic
928526640 2:32148182-32148204 CTCAGTCTCTCAGAGTGCTTGGG + Intronic
928643028 2:33320115-33320137 CTCAGCCTCCCAAAGTGCTTGGG - Intronic
928653028 2:33421935-33421957 GTAAGGATCTCAAAGTTGTTAGG - Intergenic
929198184 2:39207848-39207870 CTAAGCCTCCCAAAGTGCTGGGG - Intronic
929503673 2:42511463-42511485 CTTGGCCTCTCAAAGTGTTGGGG - Intronic
929640229 2:43571002-43571024 CTCAGCCTCCCAAAGTGTTGTGG - Intronic
930212426 2:48654633-48654655 CTCAGCCTCTCAAAGTGCTGGGG + Intronic
930319136 2:49832211-49832233 CTCGGCCTCCCAAAGTGTTTGGG - Intergenic
930654148 2:53991654-53991676 CTCAGTCTCCCAAAGTGTTGGGG + Intronic
931347890 2:61463209-61463231 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
932071105 2:68621428-68621450 CTCAGCCTCCCAAAGTGTTGAGG - Intronic
932172958 2:69574117-69574139 CTCAGCCTCCCAAAGTGCTTGGG - Intronic
932203925 2:69860240-69860262 CTCAGCCTCCCAAAGTGCTTGGG + Intronic
932205349 2:69875939-69875961 CTCAGGCTCCCAAAGTGCTGGGG + Intronic
932205977 2:69883137-69883159 CTTAGCCTCCCAAAGTGTTGGGG - Intergenic
932234602 2:70110911-70110933 CTCAGCCTCTCAAAGTGTGCTGG - Intergenic
932509198 2:72268361-72268383 CTCTGCCTCCCAAAGTGTTTGGG + Intronic
933663773 2:84948143-84948165 CTCAGCCTCCCAAAGTGTTAGGG + Intergenic
933703413 2:85272540-85272562 CTTAGCCTCCCAAAGTGCTTGGG - Intronic
934060390 2:88286909-88286931 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
934570784 2:95372054-95372076 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
934661116 2:96144234-96144256 AAAAGGCCCTCAAAGTGGTTGGG + Exonic
934843937 2:97649566-97649588 CTCAGCCTCCCAAAGTGTTGTGG - Intergenic
936451167 2:112635010-112635032 CTAAGGATCTCAAACTGGTGCGG + Intergenic
936693762 2:114923973-114923995 CTTAGGCTCTCAAAATGCTGGGG + Intronic
938093097 2:128446088-128446110 CTCAGCCTCCCAAAGTGTTCAGG + Intergenic
938537792 2:132259250-132259272 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
940304643 2:152212464-152212486 CTCAGACTCCCAAAGTGTTAGGG + Intergenic
940424491 2:153515003-153515025 CTAAGGGTTTTTAAGTGTTTTGG + Intergenic
940719399 2:157265499-157265521 CTAGGGCTTTCACAGTATTTAGG - Intronic
940754352 2:157664980-157665002 CTAGGCCTCTCAAAGTGCTGGGG - Intergenic
941323322 2:164082546-164082568 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
941521991 2:166557059-166557081 CTTGGCCTCCCAAAGTGTTTTGG - Intergenic
941793568 2:169576522-169576544 CTCAGCCTCCCAAAGTGCTTGGG + Intergenic
942008806 2:171737668-171737690 CTCGGGCTCCCAAAGTGGTTGGG + Intronic
942356018 2:175110855-175110877 CTCAGCCTCCCAAAGTGCTTGGG + Intronic
942577784 2:177383229-177383251 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
944049954 2:195456303-195456325 CTAGGCCTCTCAAAGTGCTGGGG + Intergenic
944115381 2:196180373-196180395 CTCAGGACCTCAAAGAGTTTTGG - Intergenic
944260277 2:197668757-197668779 CTAAGTCTCGGGAAGTGTTTGGG + Intronic
944315753 2:198284223-198284245 CTTAGTCTCCCAAAGTGTTGGGG - Intronic
944548292 2:200820426-200820448 CTCAGGCTCCCAAAGTGTTGGGG - Intronic
944717923 2:202393545-202393567 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
945277025 2:207998250-207998272 CTAGGCCTCTCAAACTGTTGGGG - Intronic
945825288 2:214714103-214714125 CTCAGCCTCACAAAGTGTTGGGG - Intergenic
945862885 2:215144036-215144058 GCAAGTCTCTCAGAGTGTTTTGG - Intergenic
946202926 2:218081510-218081532 CTATGGATCTTACAGTGTTTGGG - Intronic
946809874 2:223512410-223512432 CTATGTGTCTAAAAGTGTTTTGG - Intergenic
947386340 2:229594335-229594357 CTTGGCCTCTCAAAGTGTTGGGG - Intronic
947463485 2:230322639-230322661 CTAAGGGTATCTAAGGGTTTAGG - Intergenic
947469164 2:230384659-230384681 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
948624275 2:239259195-239259217 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1168746840 20:250554-250576 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1169650433 20:7860631-7860653 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1169708911 20:8539036-8539058 CTCAGACTCTCAAAGTGCTGGGG + Intronic
1170977164 20:21175761-21175783 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1171889865 20:30701052-30701074 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1171908413 20:30920281-30920303 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1172281589 20:33711615-33711637 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1172287642 20:33752395-33752417 CTCAGGCACTCAAAGAGATTCGG - Intronic
1172549669 20:35789162-35789184 CTAAGCCTCCCAAAGTGCTGGGG - Intronic
1173597326 20:44267356-44267378 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1173944791 20:46942006-46942028 CTCAGCCTCCCAAAGTGTTGAGG + Intronic
1174262160 20:49304415-49304437 CTCAGCCTCTCAAAGTGCTAGGG - Intergenic
1174498038 20:50963175-50963197 CTCAGCCTCCCAAAGTGCTTGGG + Exonic
1174529234 20:51197873-51197895 CTCAGCCTCTCAAAGTGCTAAGG - Intergenic
1174761844 20:53214452-53214474 CTCAGCCTCCCAAAGTGTTGAGG - Intronic
1175331848 20:58170220-58170242 CTCAGCCTCTCAAAGTGTTGGGG - Intergenic
1176208386 20:63903832-63903854 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1176359983 21:5987199-5987221 CTCAGGCACTCAAAGAGATTTGG - Intergenic
1176609124 21:8861753-8861775 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1176854646 21:13956395-13956417 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1177862134 21:26466680-26466702 CTAAGACTCTCAAAGTGCCAGGG - Exonic
1179147892 21:38784774-38784796 CTCAGGCTCCCAAAGTGCTGGGG - Intergenic
1179216696 21:39373245-39373267 CTTGGCCTCTCAAAGTGTTTGGG + Intergenic
1179763535 21:43551351-43551373 CTCAGGCACTCAAAGAGATTTGG + Intronic
1180341847 22:11626453-11626475 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1180359216 22:11871584-11871606 CTCAGCCTCTCAAAGTGCTGCGG + Intergenic
1180924370 22:19543781-19543803 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1181080220 22:20409179-20409201 CTCAGCCTCTCAAAGTGTTGGGG + Intergenic
1181294231 22:21822164-21822186 CTTAGCCTCCCAAAGTGCTTGGG - Intronic
1181426043 22:22839792-22839814 CTAAGCCTCCCAAAGTTTCTGGG + Intronic
1182220170 22:28752481-28752503 CTCAGCCTCTCAAAGTGCTGGGG - Intronic
1182449777 22:30412560-30412582 CAAACACTCACAAAGTGTTTGGG - Intronic
1182578215 22:31288123-31288145 CTCAGCCTCCCAAAGTGTATAGG - Intronic
1182721782 22:32408004-32408026 CTTGGTCTCTCAAAGTGTTGCGG + Intronic
1182948081 22:34343824-34343846 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1183296360 22:37031816-37031838 CTATGCCTCCCAAAGTGTTGAGG - Intergenic
1183407197 22:37636172-37636194 CTCAGCCTCCCAAAGTGTTGTGG + Intronic
1183570316 22:38648354-38648376 CTCAGCCTCCCAAAGTGCTTGGG - Intronic
1184145847 22:42609919-42609941 CTCAGCCTCCCAAAGTGCTTGGG - Intronic
1184270493 22:43379014-43379036 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1185306753 22:50122039-50122061 CTCAGCCTCCCAAAGTGCTTGGG + Intronic
949646271 3:6098438-6098460 CTAGGGCTCCCATGGTGTTTTGG + Intergenic
949849488 3:8408493-8408515 ACTTGGCTCTCAAAGTGTTTAGG + Intergenic
950093504 3:10314229-10314251 CTCAGCCTCCCAAAGTGTTAAGG + Intronic
950301140 3:11880142-11880164 CTCAGCCTCCCAAAGTGTTAGGG + Intergenic
950314120 3:11985606-11985628 CTCAGCCTCCCAAAGTGTTAGGG + Intergenic
950355459 3:12404550-12404572 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
950375709 3:12570623-12570645 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
951525349 3:23647900-23647922 GTGAGGCTCACAGAGTGTTTTGG - Intergenic
951748780 3:26010456-26010478 CTCAGCCTCTCAAAGTGTTGGGG + Intergenic
952218019 3:31296802-31296824 ATAAGGCTATAAAAGTATTTGGG + Intergenic
952386330 3:32844013-32844035 CTTCGGCTCTCATAGTTTTTAGG - Intronic
953900578 3:46839695-46839717 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
953952502 3:47202347-47202369 CTCAGCCTCTCAAAGTGCTTAGG - Intergenic
954053492 3:48002627-48002649 CTCAGGCTCTCAAATTGTTGGGG - Intronic
954263750 3:49458172-49458194 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
954879869 3:53827027-53827049 CTTAGCCTCCCAAAGTGTTGGGG - Intronic
955620833 3:60862417-60862439 CTAGGCCTCCCAAAGTGCTTGGG + Intronic
956532175 3:70232647-70232669 CTCAGCCTCCCAAAGTGCTTAGG + Intergenic
959065925 3:101657252-101657274 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
959095739 3:101953391-101953413 TTAAGCCTCTAACAGTGTTTGGG + Intergenic
959639996 3:108621944-108621966 CTCAGCCTCTCAAAGTGCTGGGG - Intronic
959757654 3:109917930-109917952 CTGAGGCTCTCAAAGGCTTTGGG + Intergenic
960625753 3:119680487-119680509 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
960882832 3:122363248-122363270 TTAAAGCTCTCAAGGTGATTAGG - Intronic
961007500 3:123414806-123414828 CTCAGCCTCCCAAAGTGCTTGGG + Intronic
961502287 3:127345107-127345129 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
961854123 3:129852203-129852225 CTCAGCCTCCCAAAGTGTTGAGG - Intronic
961946646 3:130697321-130697343 CTCAGCCTCCCAAAGTGCTTGGG + Intronic
962477517 3:135769200-135769222 TTCAGCCTCCCAAAGTGTTTGGG + Intergenic
962521987 3:136205766-136205788 CTAGGGCACTCAAAGAGATTCGG - Intergenic
962544725 3:136421020-136421042 CTCGGCCTCTCAAAGTGTTGGGG + Intronic
963198352 3:142559650-142559672 CTCAGGCTCCCAAAGTCATTTGG - Intronic
963200587 3:142582008-142582030 CTCAGGCTCCCAAAGTGCTGGGG - Intergenic
963202968 3:142602936-142602958 CTCAGCCTCCCAAAGTGTTGAGG + Intronic
963204670 3:142620376-142620398 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
963618737 3:147576965-147576987 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
963879660 3:150514812-150514834 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
964678844 3:159315477-159315499 CTCAGCCTCCCAAAGTGTTTAGG + Intronic
964836507 3:160944498-160944520 CTAAGACTCTCTAACTTTTTAGG + Intronic
964845970 3:161044486-161044508 CTCAGCCTCCCAAAGTGCTTGGG - Intronic
964979251 3:162659030-162659052 CTATGTCTATCAAAGTGTGTAGG + Intergenic
965577668 3:170234280-170234302 CTCAGGCTCCCAAAGTGCTGGGG + Intronic
966235584 3:177698298-177698320 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
966485524 3:180465083-180465105 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
966801321 3:183766924-183766946 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
966827159 3:183974557-183974579 CTCAGCCTCCCAAAGTGCTTAGG + Intronic
967500151 3:190187926-190187948 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
968366536 3:198189574-198189596 CTCAGCCTCCCAAAGTGCTTGGG + Intergenic
968785139 4:2616050-2616072 CTCAGCCTCCCAAAGTGCTTGGG + Intronic
969263693 4:6050309-6050331 CTAAGGCTCTGAAAGTTTACAGG + Intronic
969710146 4:8838490-8838512 CTGAGGCTCTGACAGTGTCTCGG - Intergenic
970008299 4:11430579-11430601 CTAAAGAGCTCAAAGTGCTTTGG + Intergenic
970061262 4:12037082-12037104 CAGAGGCTCTCAGAGTGTATGGG - Intergenic
970179762 4:13378957-13378979 CTCAGTCTCCCAAAGTGTTGGGG - Intronic
971003578 4:22349879-22349901 CTCAGCCTCCCAAAGTGTTAGGG - Intronic
971241183 4:24890338-24890360 CTAAGGCTCTAAGAGTTTTTTGG + Intronic
971320213 4:25599525-25599547 CTTAGCCTCCCAAAGTGCTTAGG + Intergenic
971408880 4:26348956-26348978 CTAGGCCTCCCAAAGTGTTGAGG + Intronic
971783510 4:31069974-31069996 ATAATGCACTCAAAGTATTTGGG - Intronic
973819612 4:54651512-54651534 CTCAGCCTCTCAAAGTGGTGGGG + Intergenic
973985786 4:56351678-56351700 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
974019311 4:56678695-56678717 CTCAGCCTCTCAAAGTGCTGGGG + Intronic
974646017 4:64693822-64693844 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
975132445 4:70842550-70842572 CTCAGCCTCCCAAAGTGCTTGGG + Intergenic
975863271 4:78700546-78700568 CTCAGCCCCTCAAAGTGTTCAGG - Intergenic
976996032 4:91435186-91435208 CTCAGCCTCCCAAAGTGCTTGGG - Intronic
977598439 4:98910070-98910092 CTCAGGCTATTAAACTGTTTTGG + Intronic
977837126 4:101657937-101657959 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
978174658 4:105715638-105715660 CTAAGAAGCTTAAAGTGTTTAGG + Intronic
979823644 4:125205609-125205631 CTAAGTCTCTCAAACTATGTAGG - Intergenic
980314956 4:131186825-131186847 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
981683398 4:147426202-147426224 CTCAGGCACTCAAAGAGATTCGG - Intergenic
981807629 4:148735162-148735184 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
981919583 4:150072817-150072839 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
982167886 4:152631680-152631702 CTCAGCCTCTCAAAGTGCTGGGG + Intronic
982316243 4:154034905-154034927 CTAAGGACCCCAAAGGGTTTGGG + Intergenic
982553067 4:156826452-156826474 CTTGGCCTCTCAAAGTGTTGGGG + Intronic
983085380 4:163437238-163437260 GTAAAGCTCTAATAGTGTTTAGG + Intergenic
983472759 4:168176747-168176769 CTCAGCCTCTCAAAATGTTGGGG - Intronic
983669337 4:170217306-170217328 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
983726167 4:170929520-170929542 CTCGGCCTCTCAAAGTGTTGGGG - Intergenic
984495588 4:180493295-180493317 CTAAGGGACTGAAAGTATTTAGG + Intergenic
984674667 4:182533298-182533320 CTCAGCCTCTCAAAGTGCTTGGG - Intronic
985163451 4:187067972-187067994 CTCGGGCTCTCAAAGTGCTGAGG + Intergenic
985252741 4:188040516-188040538 CTAAGCCTCCCAAAGTGCTGGGG - Intergenic
1202770122 4_GL000008v2_random:196771-196793 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
985612007 5:894494-894516 TTAATACACTCAAAGTGTTTAGG - Intronic
986684896 5:10268110-10268132 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
986727116 5:10606980-10607002 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
986897565 5:12388393-12388415 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
987454824 5:18130546-18130568 CTAGGTCTCCCAAAGTGTTGGGG - Intergenic
987516376 5:18916299-18916321 CTAAGGCTCTCTTAGTCATTTGG + Intergenic
988902099 5:35744958-35744980 CTAGGGCACTCATAGTATTTGGG - Intronic
989054727 5:37355976-37355998 CTCGGCCTCCCAAAGTGTTTGGG - Intronic
991426502 5:66498041-66498063 CTTGGCCTCTCAAAGTGTTGGGG - Intergenic
992045084 5:72879934-72879956 CTCAGGCTCCCAAAGTGCTGAGG - Intronic
992124844 5:73629244-73629266 TTCAGCCTCTCAAAGTGTTGGGG - Intronic
992500884 5:77342155-77342177 CTAAGGCTTTCAAAAGGCTTTGG - Intronic
992656326 5:78913373-78913395 CTCAGCCTCTCAAAGTGCTTGGG + Intronic
992718285 5:79533023-79533045 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
992801018 5:80296104-80296126 CATAGTGTCTCAAAGTGTTTAGG - Intergenic
994190793 5:96867256-96867278 CTCAGCCTCCCAAAGTGTTAGGG + Intronic
995174389 5:109158125-109158147 CTCAGGCTCCCAAAGTGCTGAGG - Intronic
995892820 5:116975185-116975207 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
996491288 5:124100697-124100719 CTCAGTCTCCCAAAGTGCTTGGG - Intergenic
996525112 5:124471290-124471312 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
996808368 5:127483652-127483674 CTCAGCCTCCCAAAGTGTCTGGG + Intergenic
997569554 5:134915700-134915722 CTCAGCCTCTCAAAGTATTGGGG + Intronic
998234884 5:140390005-140390027 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
998808392 5:145940838-145940860 CTAAGGCTCTCAAAGTGTTTTGG - Intronic
999158651 5:149476844-149476866 CTTAGCCTCTCAAAGTGCTGGGG - Intergenic
999225171 5:150016091-150016113 CTCAGTCTCTCAAAGTGCTAGGG - Intronic
1000487263 5:161862762-161862784 AGATGCCTCTCAAAGTGTTTTGG + Intronic
1001391116 5:171380082-171380104 ATGAGCCTCTCAAAGTGTTCGGG + Intergenic
1001618848 5:173064958-173064980 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1002032925 5:176444004-176444026 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
1002049090 5:176559424-176559446 CTAATACTCTCAAAATGCTTTGG + Intronic
1002725759 5:181294784-181294806 CTCAGCCTCCCAAAGTGCTTGGG + Intergenic
1002840451 6:900691-900713 CAAAGGCTTTGAAACTGTTTCGG + Intergenic
1003501680 6:6708326-6708348 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
1003875431 6:10432091-10432113 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1004198305 6:13525419-13525441 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1004357008 6:14938558-14938580 CTCAGCCTCCCAAAGTGCTTGGG + Intergenic
1004454058 6:15774869-15774891 CTCAGCCTCCCAAAGTGCTTGGG + Intergenic
1004684512 6:17929791-17929813 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1004695085 6:18025983-18026005 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1004697791 6:18050229-18050251 CTCAGACTCTTAAAGTGTTTGGG - Intergenic
1004803430 6:19176377-19176399 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1005255738 6:24001124-24001146 CTCTGCTTCTCAAAGTGTTTGGG + Intergenic
1005717770 6:28567933-28567955 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1006002548 6:30976692-30976714 CTCAGCCTCCCAAAGTGTTGAGG - Intergenic
1006631257 6:35431633-35431655 CTCAGCCTCCCAAAGTGTTAGGG + Intergenic
1006656066 6:35594101-35594123 CTCAGCCTCCCAAAGTGCTTGGG - Intronic
1006708525 6:36044621-36044643 CTCAGCCTCTCAAAGTGTTTGGG - Intronic
1006858558 6:37153698-37153720 CTCAGGCTCCCAAAGTGCTGGGG - Intergenic
1007028643 6:38605296-38605318 CTCAGCCTCCCAAAGTGCTTGGG + Intronic
1007034603 6:38661810-38661832 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1007188125 6:39990030-39990052 CTAGGCCTCTCAAAGTGCTGGGG - Intergenic
1007783545 6:44267575-44267597 CTCAGCCTCTCAAAGTTTATAGG - Intergenic
1008119243 6:47592085-47592107 CTCAGCCTCCCAAAGTGTTTGGG + Intronic
1008354323 6:50533444-50533466 CTCAGTCTTTCAAAGTGCTTGGG + Intergenic
1008596755 6:53049970-53049992 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1008680577 6:53867701-53867723 CTAAGCCTCCTAAAGTGTTTGGG - Intronic
1009768868 6:68119424-68119446 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1010717774 6:79249415-79249437 CTAAGGCACTACAAGTTTTTAGG + Intergenic
1011168504 6:84478824-84478846 CTGGGGCTCTCACAGTATTTGGG - Intergenic
1011379725 6:86730163-86730185 CTGCGGCTCTCAAAGTGCCTGGG + Intergenic
1011453535 6:87522078-87522100 CTTAGCCTCCCAAAGTGCTTGGG - Intronic
1011471089 6:87708548-87708570 CTCAGTCTCCCAAAGTGTTGGGG - Intergenic
1011498465 6:87962065-87962087 CTCAGCCTCCCAAAGTGCTTTGG - Intergenic
1013310251 6:108887161-108887183 CTAAGCCTCCCAAAGTGCTGTGG + Intronic
1013939957 6:115649125-115649147 CTAAGTCTCTCAAAATATTAAGG + Intergenic
1014117764 6:117685601-117685623 CTCAGCCTCCCAAAGTGTTTGGG + Intronic
1014238541 6:118989210-118989232 CTCAGCCTCCCAAAGTGCTTGGG + Intronic
1014452316 6:121595690-121595712 CAAAGGCTTCCAATGTGTTTTGG - Intergenic
1014690903 6:124562523-124562545 TTAAGGTTCTCAAAGAATTTTGG + Intronic
1014795610 6:125720817-125720839 CTAAGGATCTCACAGTGGTGAGG - Intergenic
1015115660 6:129646482-129646504 CTAAGACCCTCAAAGAGCTTTGG + Intronic
1015221420 6:130808185-130808207 CTCAGTCTCTCAAAGTGTTGGGG - Intergenic
1015275071 6:131375691-131375713 CTAAGGATTTCAATGTGCTTTGG - Intergenic
1015540075 6:134305104-134305126 CTTGGCCTCCCAAAGTGTTTTGG - Intronic
1015795911 6:137010983-137011005 CTCAGCTTCTCAAAGTGTTAGGG - Intronic
1017253748 6:152310188-152310210 CTCAGCCTCTCAAAGTGCTGGGG - Intronic
1017811443 6:157986583-157986605 CTCAGCCTCTCAAAGTGCTGGGG + Intronic
1018104598 6:160471262-160471284 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1018540272 6:164872318-164872340 ATAATGTTTTCAAAGTGTTTTGG - Intergenic
1019012743 6:168855130-168855152 CTCAGCCTCTCAAAGTATTTGGG + Intergenic
1019798500 7:3070332-3070354 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1019981541 7:4625008-4625030 CTCAGACTCCCAAAGTGTTAAGG - Intergenic
1020216108 7:6191961-6191983 CTCAGGCTCCCAAAGTGACTGGG - Intronic
1020363530 7:7355356-7355378 CTCAGCCTCCCAAAGTGTTTGGG - Intergenic
1020659740 7:10967589-10967611 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1020857240 7:13444604-13444626 GTATGGCTTTCAAAGTGTATGGG - Intergenic
1021184622 7:17549061-17549083 CTCAGTCTCCCAAAGTGCTTGGG - Intergenic
1021519239 7:21522626-21522648 CTCAGCCTCTCAAAGTGTTGGGG + Intergenic
1021724288 7:23534432-23534454 CTAGGCCTCCCAAAGTGTTGAGG + Intergenic
1021797351 7:24269752-24269774 CTCAGCCTCTCAAAGTGCCTGGG + Intergenic
1022412703 7:30151590-30151612 CGAATTCTCTCAAAGTGTTATGG + Intronic
1022730157 7:33015314-33015336 CCAGGCCTCTCAAAGTGCTTGGG - Intronic
1022820224 7:33952374-33952396 CTTATCATCTCAAAGTGTTTTGG + Intronic
1023361383 7:39419489-39419511 CTCAGCCTCTCAAAGTGCTGGGG + Intronic
1023384603 7:39643467-39643489 CTCAGCCTCTCAAAGTGCTGGGG - Intronic
1023695592 7:42842989-42843011 CTCGGCTTCTCAAAGTGTTTGGG - Intergenic
1023926857 7:44675624-44675646 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1023928344 7:44687672-44687694 CTCAGCCTCCCAAAGTGCTTGGG + Intronic
1023934378 7:44729001-44729023 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1025085482 7:56019963-56019985 CTCAGCTTCCCAAAGTGTTTGGG - Intronic
1025114268 7:56244297-56244319 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1025187008 7:56869080-56869102 CTTGGTCTCTCAAAGTATTTGGG - Intergenic
1025188514 7:56879443-56879465 CTCGGCCTCCCAAAGTGTTTGGG - Intergenic
1025214913 7:57048134-57048156 CTTGGCCTCTCAAAGTGTTGAGG - Intergenic
1025657040 7:63528676-63528698 CTTGGCCTCTCAAAGTGTTGAGG + Intergenic
1025684912 7:63707829-63707851 CTTGGTCTCTCAAAGTATTTGGG + Intergenic
1025763754 7:64421282-64421304 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026180932 7:68040182-68040204 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1026420574 7:70232628-70232650 CTCGGCCTCTCAAAGTGTTGAGG + Intronic
1026535920 7:71238474-71238496 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1026646008 7:72169572-72169594 CTCAGCCTCTCAAAGTGCTGAGG + Intronic
1026686124 7:72511725-72511747 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
1026748007 7:73027730-73027752 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1026751655 7:73055875-73055897 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1026755304 7:73084002-73084024 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1026758954 7:73112016-73112038 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1026832715 7:73620016-73620038 CTCAGCCTCCCAAAGTGCTTAGG - Intronic
1026835212 7:73634278-73634300 CTCAGCCTCTCAAAGTGTTTTGG - Intergenic
1027034211 7:74913044-74913066 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1027088452 7:75281457-75281479 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1027092095 7:75309385-75309407 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1027095738 7:75337352-75337374 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1027170677 7:75870012-75870034 CTCAGCCTCCCAAAGTGTTGTGG - Intronic
1027323602 7:77030334-77030356 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1027452716 7:78351253-78351275 CTAAGCCTCCCAAAGTGCTGGGG - Intronic
1029256102 7:99270665-99270687 CTGAGCCTCCCAAAGTGCTTGGG - Intergenic
1029791016 7:102843190-102843212 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1029871586 7:103698764-103698786 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1030541448 7:110835475-110835497 CTAGGGCTCTCAGGATGTTTGGG - Intronic
1030541682 7:110837980-110838002 CTAGGGCACTCAATTTGTTTTGG + Intronic
1031432167 7:121685088-121685110 CTAAGCCTCCCAAAGTGCTGGGG + Intergenic
1032028244 7:128460594-128460616 CTAAGCCTCCCAAAGTGCTGGGG - Intergenic
1032337049 7:131035041-131035063 CTCCGCCTCCCAAAGTGTTTGGG - Intergenic
1033125631 7:138704811-138704833 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1033360074 7:140632814-140632836 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1033850899 7:145493396-145493418 CTTAGCCTCCCAAAGTGTTGGGG + Intergenic
1035428618 7:158799876-158799898 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1036377772 8:8215263-8215285 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1036465413 8:8992794-8992816 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
1036959497 8:13228489-13228511 CTCAGCCTCCCAAAGTGTTGGGG - Intronic
1036965488 8:13292969-13292991 CTCAGCCTCTCAAAGTGCTGGGG - Intronic
1037338056 8:17811305-17811327 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1037705942 8:21315173-21315195 CTCAGTCTCCCAAAGTGTTGGGG + Intergenic
1037797908 8:22011563-22011585 CTAAGTCTCCCAAAGTGCTGGGG - Intergenic
1037879976 8:22568101-22568123 CTCAGCCTCCCAAAGTGCTTGGG + Intronic
1038251251 8:25907165-25907187 CTAGGCCTCTCAAAGTGCTGGGG - Intronic
1038316277 8:26487121-26487143 CTCAGACTCTCAAAGTGCTAGGG + Intronic
1038537527 8:28364398-28364420 CTTGGCCTCCCAAAGTGTTTGGG - Intronic
1038771029 8:30480186-30480208 CTGAAGCACTCAGAGTGTTTAGG + Intronic
1039071700 8:33654749-33654771 CTAAGCCTCCCAAAGTGCTGGGG - Intergenic
1039457858 8:37719871-37719893 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1039505604 8:38050161-38050183 CTCAGCCTCCCAAAGTGTTGGGG + Intronic
1039673840 8:39636235-39636257 CTCAGTCTCCCAAAGTGTTGGGG + Intronic
1039714888 8:40097293-40097315 CTAAGCCACCCAAAGTGCTTGGG + Intergenic
1039868008 8:41522585-41522607 CTCAGCCTCCTAAAGTGTTTGGG - Intergenic
1040057133 8:43068961-43068983 CTCAGCCTCTCAAAGTGCTGGGG + Intronic
1040363223 8:46687209-46687231 CTTAGCCTCCCAAAGTGTTGGGG + Intergenic
1040404893 8:47090167-47090189 CTAAGGCTCTTACAGTGGTGTGG - Intergenic
1040509571 8:48082107-48082129 CTCAGTCTCTCAAAGTGCTGGGG - Intergenic
1040522588 8:48191290-48191312 CTCCGGCTCCCAAAGTGTTGGGG - Intergenic
1042251609 8:66761515-66761537 CTCAGCCTCTCAAAGTGCTGGGG - Intronic
1042717215 8:71787306-71787328 CTCAGCCTCTCAAACTGTTGAGG - Intergenic
1042825288 8:72973540-72973562 CTCAGGCTCCCAAAGTGCTGGGG + Intergenic
1043325503 8:79045839-79045861 CTCAGGCTCCCAAAGTGTTAGGG - Intergenic
1043482161 8:80664520-80664542 CTCAGCCTCCCAGAGTGTTTGGG + Intronic
1043525480 8:81092099-81092121 CTTAGCCTCCCAAAGTGTTGGGG - Intronic
1044012304 8:87009549-87009571 CTCAGCCTCTCAAAGTGTGCTGG + Intronic
1046544809 8:115636660-115636682 CTCAGGCTCCCAAAGTGTTGGGG - Intronic
1047459543 8:125049305-125049327 CTAAGCCTCCCAAAGTGCTGGGG - Intronic
1047594046 8:126358490-126358512 CTCAGCCTCTCAAAGTGCTGTGG + Intergenic
1047608363 8:126496769-126496791 CTCAGGCTCCCAAAGTGCTGGGG + Intergenic
1048432668 8:134384756-134384778 CTCAGCCTCCCAAAGTGTTAAGG - Intergenic
1050383969 9:5064276-5064298 CTCAGTCTCCCAAAGTGTTGGGG - Intronic
1050544518 9:6698478-6698500 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
1052871004 9:33506563-33506585 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1052894378 9:33733750-33733772 CTCAGGCTCCCAAAGTGCTGGGG - Intergenic
1052961825 9:34304655-34304677 ATAAGGCTGTTAAAGTGATTGGG + Intronic
1053365541 9:37520084-37520106 CTTGGCCTCTCAAAGTGTTAGGG + Intronic
1053451687 9:38198953-38198975 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1054359229 9:64097160-64097182 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1056684415 9:88747666-88747688 TAGTGGCTCTCAAAGTGTTTTGG + Intergenic
1057687511 9:97248786-97248808 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1057774044 9:97991071-97991093 CTCAGCCTCCCAAAGTGGTTGGG + Intronic
1057896186 9:98910701-98910723 AAAAGGCTTTCAGAGTGTTTTGG + Intergenic
1058526964 9:105868703-105868725 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1059557361 9:115294698-115294720 CTTAGCCTCCCAAAGTGTTGAGG - Intronic
1059578827 9:115521464-115521486 CTAAGCCTCTCAAAGAGTTTGGG + Intergenic
1060657173 9:125380186-125380208 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1060838980 9:126779520-126779542 CTCAGCCTCCCAAAGTGCTTGGG + Intergenic
1060848791 9:126858362-126858384 CTCAACCTCCCAAAGTGTTTGGG + Intergenic
1061182531 9:129033340-129033362 CTCAGACTCCCAAAGTGTTGGGG + Intergenic
1061730888 9:132613131-132613153 CTCAGCCTCTCAAAGTGCTTGGG + Intronic
1062750895 9:138252426-138252448 CTCAGCCTCCCAAAGTGCTTGGG + Intergenic
1203695021 Un_GL000214v1:90448-90470 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1203704526 Un_KI270742v1:26985-27007 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1203559476 Un_KI270744v1:38827-38849 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1203641252 Un_KI270751v1:13615-13637 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1186642147 X:11467185-11467207 CTAGGCCTCCCAAAGTGTTGGGG - Intronic
1186739537 X:12502917-12502939 CTTTTGCTCTCAAAGTGTTCTGG + Intronic
1187152330 X:16692804-16692826 CTCAGCCTCCCAAAGTGCTTGGG - Intronic
1187697083 X:21933549-21933571 CTCAGCCTCCCAAAGTGCTTGGG - Intergenic
1188996815 X:36896872-36896894 CTAAGGCTCAGAAAGTGCTCAGG - Intergenic
1189441271 X:41038322-41038344 CTCAGCCTCTCAAAGTCTTGGGG - Intergenic
1189786676 X:44565158-44565180 CTCAGCCTCTCAAAGTGCTGGGG + Intergenic
1190075424 X:47313608-47313630 CTCAGCCTCCCAAAGTGTTAAGG + Intergenic
1190754062 X:53385523-53385545 CTAGGCCTCCCAAAGTGCTTGGG + Intronic
1190770299 X:53508505-53508527 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1191636225 X:63379945-63379967 TTAGGGCTCTCAAGGTATTTGGG + Intergenic
1192403679 X:70862650-70862672 CTCAGCCTCTTAAAGTGTTGGGG - Intronic
1192870717 X:75180464-75180486 CTTGGGCTCTCACAGTATTTGGG + Intergenic
1193123543 X:77847861-77847883 CTCAGCCTCTCAAAGTGCTGGGG + Intronic
1193569385 X:83124001-83124023 CTCAGCCTCTCAAAGTGCTGGGG - Intergenic
1194809242 X:98370761-98370783 CTCAGCCTCTCAAAGTGCTGAGG - Intergenic
1195682171 X:107555553-107555575 CAGAGGTTCTCAAAGTCTTTTGG - Intronic
1196254384 X:113498803-113498825 CTAAGGCTCTCCAGGTGATCAGG - Intergenic
1196302155 X:114059648-114059670 CTCAGCCTCTCAAAATGTTGGGG + Intergenic
1196777804 X:119356366-119356388 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic
1197634568 X:128900561-128900583 CTAAGGCCCTCAATATTTTTAGG + Intergenic
1197786473 X:130202397-130202419 CTCAGCCTCTCAAAGTATTGGGG + Intergenic
1198280533 X:135137888-135137910 GTAGGGCCCTGAAAGTGTTTCGG + Intergenic
1198290426 X:135234626-135234648 GTAGGGCCCTGAAAGTGTTTCGG - Intergenic
1199725503 X:150575926-150575948 CTCAGTCTCCCAAAGTGCTTAGG + Intronic
1199753093 X:150839781-150839803 CTCAGCCTCTCAAAGTGCTGGGG - Intronic
1199779329 X:151043998-151044020 TTTTGGCTCTCTAAGTGTTTTGG + Intergenic
1200412303 Y:2872766-2872788 CTCAGCCTCCCAAAGTGTTGAGG + Intronic
1200418019 Y:2933891-2933913 CTCAGCCTTCCAAAGTGTTTTGG + Intergenic
1201016414 Y:9607201-9607223 CTCAGCCTCTGAAAGTGCTTGGG - Intergenic
1201667604 Y:16476590-16476612 CTCAGCCTCCCAAAGTGTTGGGG - Intergenic
1201711841 Y:17000940-17000962 CTCAGCCTCCCAAAGTGTTGGGG + Intergenic