ID: 998817497

View in Genome Browser
Species Human (GRCh38)
Location 5:146028900-146028922
Sequence AACACGAACGCGCTCCTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 12}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998817491_998817497 6 Left 998817491 5:146028871-146028893 CCTGTGCCCTGTCCCTGGAAATG 0: 1
1: 0
2: 1
3: 26
4: 308
Right 998817497 5:146028900-146028922 AACACGAACGCGCTCCTAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 12
998817492_998817497 0 Left 998817492 5:146028877-146028899 CCCTGTCCCTGGAAATGCGCCAA 0: 1
1: 0
2: 0
3: 10
4: 179
Right 998817497 5:146028900-146028922 AACACGAACGCGCTCCTAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 12
998817494_998817497 -6 Left 998817494 5:146028883-146028905 CCCTGGAAATGCGCCAAAACACG 0: 1
1: 0
2: 0
3: 7
4: 52
Right 998817497 5:146028900-146028922 AACACGAACGCGCTCCTAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 12
998817495_998817497 -7 Left 998817495 5:146028884-146028906 CCTGGAAATGCGCCAAAACACGA 0: 1
1: 0
2: 0
3: 3
4: 50
Right 998817497 5:146028900-146028922 AACACGAACGCGCTCCTAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 12
998817493_998817497 -1 Left 998817493 5:146028878-146028900 CCTGTCCCTGGAAATGCGCCAAA 0: 1
1: 0
2: 0
3: 4
4: 88
Right 998817497 5:146028900-146028922 AACACGAACGCGCTCCTAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 12
998817489_998817497 30 Left 998817489 5:146028847-146028869 CCACAGGTAGGATGGGGAGACTT 0: 1
1: 0
2: 0
3: 12
4: 139
Right 998817497 5:146028900-146028922 AACACGAACGCGCTCCTAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 12

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998817497 Original CRISPR AACACGAACGCGCTCCTAGC TGG Intronic
1081958114 11:47111355-47111377 AACATGAATGCACTCGTAGCGGG - Intronic
1098982613 12:76973849-76973871 AACTCTACCGAGCTCCTAGCTGG + Intergenic
1141468854 16:84225050-84225072 AACAGGACCGTGCACCTAGCAGG + Intronic
1146356917 17:32142393-32142415 AACGCGAACGCGCTCTGCGCCGG - Exonic
1164433565 19:28208901-28208923 AACAGGAGCTCGCTTCTAGCAGG + Intergenic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
1184641774 22:45876777-45876799 CTCAGGAACCCGCTCCTAGCTGG + Intergenic
962257497 3:133882569-133882591 GAGACTAAAGCGCTCCTAGCTGG + Intronic
998817497 5:146028900-146028922 AACACGAACGCGCTCCTAGCTGG + Intronic
1005040204 6:21594562-21594584 AACACGGAAGCGCTGCTGGCCGG + Exonic
1020275341 7:6621004-6621026 TACACTAACACGCTCTTAGCAGG - Intronic
1033145955 7:138870158-138870180 AGCAGGAAGGCGCTCCTAGAAGG - Intronic
1060126496 9:121052762-121052784 GACACCAAGGTGCTCCTAGCAGG + Intergenic