ID: 998819554

View in Genome Browser
Species Human (GRCh38)
Location 5:146046092-146046114
Sequence CATGTACAAAATTACGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998819551_998819554 12 Left 998819551 5:146046057-146046079 CCACACATACATTTACGCAATCA 0: 1
1: 0
2: 2
3: 12
4: 176
Right 998819554 5:146046092-146046114 CATGTACAAAATTACGTGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998819554 Original CRISPR CATGTACAAAATTACGTGGT GGG Intronic
901669410 1:10846812-10846834 CATTTAAAATATTACATGGTTGG + Intergenic
906279521 1:44543637-44543659 CATGTACAAGAGTACGTGACCGG + Intronic
910069290 1:83191734-83191756 CATGTATAAAATTCTTTGGTGGG + Intergenic
913347484 1:117822675-117822697 TATTTGCAAAATTAAGTGGTGGG + Intergenic
913580104 1:120218035-120218057 CATGTCCAAAATTGCATGGTTGG + Intergenic
913628070 1:120680359-120680381 CATGTCCAAAATTGCATGGTTGG - Intergenic
914562030 1:148829475-148829497 CATGTCCAAAATTGCATGGTTGG + Intronic
914610800 1:149300746-149300768 CATGTCCAAAATTGCATGGTTGG - Intergenic
915619432 1:157071259-157071281 CTGGTATAAAATTCCGTGGTTGG - Intergenic
916114673 1:161476581-161476603 CATGTCCCAACTTACGTGGATGG + Intergenic
916939766 1:169666025-169666047 CATGTCCCAACTTACGTGGACGG + Intronic
921575591 1:216831107-216831129 CATGTATAAAATTACCCTGTTGG - Intronic
922299878 1:224289201-224289223 AATTTACAAAAACACGTGGTGGG + Intronic
924038436 1:239959014-239959036 CATGTAGAAAATTTCGAGGCTGG + Intergenic
1066658006 10:37712793-37712815 CATGTACAAAAGCACATGGAGGG + Intergenic
1066660405 10:37734085-37734107 CATTTACAAAAACAAGTGGTGGG + Intergenic
1069511292 10:69044425-69044447 CATCTACAAAATCACATGGTAGG - Intergenic
1071348622 10:84716932-84716954 TATTTACAAAATAAGGTGGTGGG + Intergenic
1073856457 10:107680759-107680781 CATCTACAAAATTAGACGGTTGG - Intergenic
1074694296 10:116034547-116034569 CATGTACATAATTGCATTGTTGG - Intergenic
1076264573 10:129099619-129099641 CATTTACAAAAGCAGGTGGTGGG + Intergenic
1077355029 11:2112171-2112193 CATCTACGAACATACGTGGTTGG + Intergenic
1078561328 11:12375789-12375811 CATCTACAAAATGAAATGGTTGG - Intergenic
1080459873 11:32444992-32445014 CTTTTAAAAAATTACGGGGTCGG - Intergenic
1084505593 11:69564920-69564942 CATGTACAAGATCACATGGTGGG + Intergenic
1086212476 11:84337144-84337166 AATGTATAAAATTACGTTATGGG + Intronic
1088162751 11:106893340-106893362 AATGTACAAAATTTCATGGAAGG + Intronic
1089074943 11:115730582-115730604 CATGTAGATAATTACATGATAGG - Intergenic
1089851456 11:121500463-121500485 CATTTACAAAAACAGGTGGTGGG - Intronic
1092472561 12:8792275-8792297 CACGTCCCAAATTACGTGGATGG + Intergenic
1092510376 12:9149219-9149241 CATTTACAAAATTAAGTGTAAGG + Intronic
1097440603 12:59603226-59603248 CATGTACAGAATTAACTGGTAGG - Intronic
1098208671 12:68139109-68139131 CATTTCCAAAATTACTTGGAGGG - Intergenic
1098647186 12:72918057-72918079 TATTTACAAAATTAGGTGGTGGG + Intergenic
1101981740 12:109413342-109413364 CATTTACAAAATTGGATGGTAGG - Intronic
1104666648 12:130652222-130652244 CATTTACAAAAACAGGTGGTGGG - Intronic
1107318680 13:39162117-39162139 CATGTACCAAATTACTGGGATGG - Intergenic
1108725086 13:53172036-53172058 AATGTACAAAATTCTGTGATTGG + Intergenic
1108810275 13:54214609-54214631 CATGAATAAAATTAAGTGGAAGG - Intergenic
1114082394 14:19212607-19212629 CATGCAGAGAATTACGTGCTTGG + Intergenic
1114707734 14:24744400-24744422 GATGTACAGAATTACGGGCTTGG - Intergenic
1116997016 14:51335074-51335096 TAAGTACTAAATTACCTGGTAGG + Intergenic
1120007295 14:79373687-79373709 AATGCACATAATTACATGGTTGG + Intronic
1120244174 14:81986548-81986570 GAAGTACAAAATTAGCTGGTTGG - Intergenic
1122749303 14:103921042-103921064 CATGTACAGCATAACGTGGAGGG + Exonic
1123961444 15:25405955-25405977 CATTTACAAAACTACATGGCTGG - Intronic
1126928175 15:53614761-53614783 CATTTACAAAATGAGGTGGGTGG - Intronic
1127936032 15:63639132-63639154 CATCTACAAAATTACAGAGTTGG + Intronic
1128241083 15:66101393-66101415 AATGTACACAAGTAAGTGGTGGG - Intronic
1133964945 16:10524105-10524127 AATTTACAAAATCAGGTGGTGGG + Intergenic
1137527939 16:49253313-49253335 CATTTACAAAAATACGTAGTAGG + Intergenic
1137950663 16:52780658-52780680 CATTTACAAAAACAGGTGGTGGG - Intergenic
1139560099 16:67736459-67736481 CAGGTACAAAAATGCATGGTTGG - Intronic
1149000185 17:51749210-51749232 CAGTTACAAAATTACATTGTTGG - Intronic
1150915561 17:69433208-69433230 CATCTATAAAATGAGGTGGTTGG - Intronic
1152428786 17:80235885-80235907 TATTTACAAAATCAAGTGGTGGG - Intronic
1154505127 18:15030457-15030479 TGTGTACAGAATTACGTAGTTGG - Intergenic
1156796553 18:41053219-41053241 CATATATAAAATTACCTGGGGGG - Intergenic
1157681935 18:49614142-49614164 CATGTACAAAATCACATGAGCGG + Intergenic
1160412432 18:78683959-78683981 CTTGTACAAAAGTCAGTGGTAGG - Intergenic
926324536 2:11773005-11773027 TAAGTACAAAATTTAGTGGTAGG + Intronic
927173505 2:20389653-20389675 TATTTACAAAACTAGGTGGTGGG + Intergenic
931029140 2:58151825-58151847 TATTTACAAAAATAGGTGGTTGG - Intronic
932818609 2:74881044-74881066 TATGTACAAAAACAGGTGGTGGG - Intronic
941837102 2:170035686-170035708 CATCTACAAAATAACTTGCTGGG + Intronic
942272710 2:174292832-174292854 CATGTGCAAAATTATGAAGTTGG - Intergenic
942480900 2:176387083-176387105 AATGTATAAAATGACCTGGTTGG + Intergenic
945189182 2:207168170-207168192 CAAGTACCAAATTATATGGTTGG - Intergenic
1169839382 20:9918164-9918186 CATTTACAAAAATAGGTGGTGGG - Intergenic
1170415172 20:16132079-16132101 TATTTACAAAATCAGGTGGTAGG - Intergenic
1174727797 20:52881258-52881280 CATTTACAAAACTAAGTGATGGG + Intergenic
1174942403 20:54943938-54943960 CATTTAAAAAATTCCGTTGTTGG - Intergenic
1175151034 20:56934589-56934611 GTTGTACAAAATTAGGTGGTGGG + Intergenic
1176792723 21:13338619-13338641 TGTGTACAGAATTACGTAGTTGG + Intergenic
1176899202 21:14419371-14419393 GATGTATAAAATTCCTTGGTAGG + Intergenic
1176958567 21:15133930-15133952 AATGTACAAAATTACCTATTTGG + Intergenic
1177847245 21:26305246-26305268 AATGTACATAATTTCATGGTAGG + Intergenic
1177992115 21:28049516-28049538 TGTGTACAGAATTACGTAGTTGG + Intergenic
1180498383 22:15910063-15910085 CATGCAGAGAATTACGTGCTTGG - Intergenic
949326832 3:2875490-2875512 TATTTACAAAAATAGGTGGTGGG - Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
951533066 3:23716311-23716333 TATCTACAAAATTACTTGCTGGG + Intergenic
952453268 3:33450640-33450662 CATGTCCCAACTTACGTGGATGG + Intergenic
959499939 3:107094990-107095012 TATCTACAAAATAACTTGGTGGG - Intergenic
962022816 3:131517931-131517953 TATGTACAAAATTTGGTGGTTGG + Intergenic
962115516 3:132502174-132502196 ATTTTACAAAATAACGTGGTTGG + Intronic
966649010 3:182278050-182278072 CATGCAAAAAAATACGTGGGAGG + Intergenic
969147287 4:5135231-5135253 CATGTACAACACTATGAGGTAGG + Intronic
969688481 4:8690082-8690104 CATCTGCAAAATTAAGTGGTTGG + Intergenic
971648835 4:29244819-29244841 CATGGACAAAATTAGGTGTCTGG + Intergenic
972339682 4:38140726-38140748 CATGTACAAAATGAGGTGGGAGG - Intergenic
976108099 4:81641056-81641078 CATGTATAAAAGTACCTGGCTGG - Intronic
977834708 4:101634280-101634302 CATGTCCCAAATTACATGGATGG - Intronic
980052071 4:128048505-128048527 CCTGTATAAAAATAGGTGGTAGG + Intergenic
981690065 4:147498484-147498506 CATTTACAAAAACAGGTGGTGGG - Intronic
982272645 4:153606922-153606944 CATGTACAAACTTCCCTGGGAGG - Intronic
982829148 4:160039207-160039229 TATTTACAAAAATAGGTGGTGGG + Intergenic
983727413 4:170945776-170945798 AATGTACAAAATTAAGTTTTGGG + Intergenic
984489182 4:180410644-180410666 CATCTACAAAATTAAGAAGTGGG - Intergenic
991273955 5:64821337-64821359 CATTTAAAAAATTACTTTGTTGG - Intronic
991695508 5:69267239-69267261 CATGGATAAAATTACATGTTTGG - Intronic
991901128 5:71461676-71461698 CATCTACAAAATTACATAATTGG + Intronic
993806068 5:92411380-92411402 CATCTATAAAATTGGGTGGTTGG - Intergenic
995082868 5:108074462-108074484 CATTTTTAAAATTACGTGTTTGG + Intronic
998819554 5:146046092-146046114 CATGTACAAAATTACGTGGTGGG + Intronic
999643203 5:153692360-153692382 GCTGTACAAAAATAGGTGGTGGG - Intronic
1001643511 5:173262638-173262660 GATTTACAAAATCAGGTGGTGGG + Intergenic
1003232016 6:4262709-4262731 TATGTACAAAAACAGGTGGTGGG - Intergenic
1004237993 6:13892043-13892065 ACTGTACAAAATCAGGTGGTGGG + Intergenic
1005491862 6:26354545-26354567 CATGTAAAAAATTCATTGGTTGG + Intergenic
1007120465 6:39376473-39376495 CATCTGTAAAATGACGTGGTTGG - Intronic
1007980261 6:46147689-46147711 CATGGTCAAAATTACCTGGGAGG + Intergenic
1009471019 6:64028631-64028653 CATGTCCCAACTTACGTGGATGG + Intronic
1012306602 6:97666518-97666540 CATGTACAAAAGAATGTGGATGG - Intergenic
1012895678 6:104943921-104943943 CATGTATACAAGTACATGGTGGG - Intergenic
1013044519 6:106471049-106471071 CATGTAGAAAATTACAAGGGTGG - Intergenic
1014417830 6:121205890-121205912 CATGTTCAAAATTGTGTGGTTGG - Intronic
1015487175 6:133786169-133786191 CATGTTCAATATTAAGTGTTAGG + Intergenic
1016209325 6:141509119-141509141 CCTGTTCAAAATTACATGATAGG - Intergenic
1017101165 6:150851048-150851070 CATGTCCCAACTTACGTGGACGG + Intergenic
1022168781 7:27801756-27801778 CATATCTAAAATTACGTAGTTGG + Intronic
1027287069 7:76656915-76656937 CATGTATAAAATTCTTTGGTGGG + Intergenic
1029940734 7:104478263-104478285 CTTCTACAAAATTACCTGGATGG + Intronic
1031091309 7:117358722-117358744 TATGTACAAAATTTTGTGTTTGG + Intergenic
1031230232 7:119096212-119096234 CATATGCAAATTTATGTGGTGGG + Intergenic
1032809633 7:135398759-135398781 CATGCACAAAAATAAATGGTAGG - Intronic
1033353814 7:140583536-140583558 CTTGTACAAAAACAGGTGGTGGG - Intronic
1040667671 8:49653007-49653029 CATGTCCCAACTTACGTGGATGG - Intergenic
1051848963 9:21486648-21486670 TATTTACAAAAGTAGGTGGTAGG - Intergenic
1055378511 9:75679353-75679375 CATGTACAAATTAATGTGCTGGG - Intergenic
1055427700 9:76213228-76213250 CATGTATAAAATTTCATGGGAGG + Intronic
1056169855 9:83974369-83974391 CATGTACAAAATTATGTAGCAGG + Intronic
1056285470 9:85083390-85083412 TATTTACAAAAATAGGTGGTGGG + Intergenic
1057505923 9:95633376-95633398 CATGTAAAATATTAAGGGGTTGG + Intergenic
1057980673 9:99659239-99659261 AATGTACAAATTAACATGGTTGG - Intergenic
1058873811 9:109224827-109224849 CATGTGCAAAATGAGGAGGTTGG - Intronic
1059097084 9:111429495-111429517 CATGTAGAAAATGAAGGGGTTGG - Intronic
1186097598 X:6118734-6118756 CATGCTCAAAATTACATTGTGGG + Intronic
1186310259 X:8309999-8310021 TATTTACAAAACTAGGTGGTGGG + Intergenic
1186893601 X:13984434-13984456 TATTTACAAAATCAGGTGGTAGG - Intergenic
1187682258 X:21779136-21779158 CACGTACAAAACTCTGTGGTGGG + Intergenic
1188527775 X:31104933-31104955 TATTTACAAAATTAAGTGGCAGG - Intronic
1188951796 X:36384913-36384935 CACGGACAAAATTATGTGGACGG - Exonic
1190958297 X:55219571-55219593 TCTGAACAAAATTAAGTGGTAGG - Intronic
1195792406 X:108602601-108602623 CATTTCCAAAATTATATGGTAGG + Intronic
1197983103 X:132239029-132239051 CATATTCAAATTTACTTGGTTGG + Intergenic
1199590399 X:149462625-149462647 CATTTACAAAAGCAAGTGGTGGG + Intergenic
1199722884 X:150555350-150555372 CATGTACAGAATTATGAAGTTGG + Intergenic
1201908043 Y:19105201-19105223 CACGTCCCAAATTACGTGGATGG - Intergenic